Transcript: Mouse NM_029887.3

Mus musculus Yip1 interacting factor homolog B (S. cerevisiae) (Yif1b), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-06-08
Taxon:
Mus musculus (mouse)
Gene:
Yif1b (77254)
Length:
1144
CDS:
69..1004

Additional Resources:

NCBI RefSeq record:
NM_029887.3
NBCI Gene record:
Yif1b (77254)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_029887.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000126171 GCTGCGTAAGTGGCCCTCAAA pLKO.1 110 CDS 100% 1.650 1.320 N Yif1b n/a
2 TRCN0000126170 CGTCAGCAAGCTCAAGTATTA pLKO.1 374 CDS 100% 13.200 9.240 N Yif1b n/a
3 TRCN0000244659 TGGCCTTCTTGGGCTACAAAT pLKO_005 727 CDS 100% 13.200 9.240 N YIF1B n/a
4 TRCN0000126169 CTTTGGAAAGATCGGCTACTA pLKO.1 785 CDS 100% 4.950 3.465 N Yif1b n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_029887.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12941 pDONR223 100% 75% 74.8% None (many diffs) n/a
2 ccsbBroad304_12941 pLX_304 0% 75% 74.8% V5 (many diffs) n/a
3 TRCN0000467621 CGACGAAGTTCTCCGTGTCATCAA pLX_317 26.1% 75% 74.8% V5 (many diffs) n/a
Download CSV