Construct: ORF TRCN0000467621
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF004316.1_s317c1
- Derived from:
- ccsbBroadEn_12941
- DNA Barcode:
- CGACGAAGTTCTCCGTGTCATCAA
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- YIF1B (90522)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000467621
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
---|---|---|---|---|---|---|---|---|
1 | human | 90522 | YIF1B | Yip1 interacting factor hom... | XM_017027449.1 | 100% | 100% | |
2 | human | 90522 | YIF1B | Yip1 interacting factor hom... | NM_001145463.2 | 98.4% | 97.9% | (many diffs) |
3 | human | 90522 | YIF1B | Yip1 interacting factor hom... | XM_017027450.1 | 97.4% | 96.9% | (many diffs) |
4 | human | 90522 | YIF1B | Yip1 interacting factor hom... | XM_017027451.1 | 95.6% | 94.5% | (many diffs) |
5 | human | 90522 | YIF1B | Yip1 interacting factor hom... | NM_001039673.3 | 87.6% | 80.2% | (many diffs) |
6 | human | 90522 | YIF1B | Yip1 interacting factor hom... | NM_001039672.3 | 86.8% | 79.5% | (many diffs) |
7 | human | 90522 | YIF1B | Yip1 interacting factor hom... | NM_001039671.3 | 83.6% | 75.3% | (many diffs) |
8 | human | 90522 | YIF1B | Yip1 interacting factor hom... | NM_001145461.2 | 82.5% | 75.1% | (many diffs) |
9 | human | 90522 | YIF1B | Yip1 interacting factor hom... | NM_001145462.2 | 78.8% | 71.7% | (many diffs) |
10 | human | 90522 | YIF1B | Yip1 interacting factor hom... | XM_005259385.4 | 78.8% | 71.7% | (many diffs) |
11 | mouse | 77254 | Yif1b | Yip1 interacting factor hom... | NM_001110201.1 | 75.7% | 75.5% | (many diffs) |
12 | mouse | 77254 | Yif1b | Yip1 interacting factor hom... | NM_029887.3 | 75% | 74.8% | (many diffs) |
13 | mouse | 77254 | Yif1b | Yip1 interacting factor hom... | NM_001357664.1 | 73.1% | 72.6% | (many diffs) |
14 | mouse | 77254 | Yif1b | Yip1 interacting factor hom... | NM_001357666.1 | 68.3% | 68.1% | (many diffs) |
15 | mouse | 77254 | Yif1b | Yip1 interacting factor hom... | NM_001357668.1 | 68.3% | 68.1% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 948
- ORF length:
- 882
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgca cccggcaggc ttggcggcgg cggctgcggg gacgccccgg ctgccctcga 121 agcggaggat ccctgtgtcc cagccgggca tggccgaccc ccaccagctt ttcgatgaca 181 caagttcagc ccagagccgg ggctatgggg cccagcgggc acctggtggc ctgagttatc 241 ctgcagcctc tcccacgccc catgcagcct tcctggctga cccggtgtcc aacatggcca 301 tggcctatgg gagcagcctg gccgcgcagg gcaaggagct ggtggataag aacatcgacc 361 gcttcatccc catcaccaag ctcaagtatt actttgctgt ggacaccatg tatgtgggca 421 gaaagctggg cctgctgttc ttcccctacc tacaccagga ctgggaagtg cagtaccaac 481 aggacacccc ggtggccccc cgctttgacg tcaatgcccc ggacctctac attccagcaa 541 tggctttcat cacctacgtt ttggtggctg gtcttgcgct ggggacccag gataggttct 601 ccccagacct cctggggctg caagcgagct cagccctggc ctggctgacc ctggaggtgc 661 tggccatcct gctcagcctc tatctggtca ctgtcaacac cgacctcacc accatcgacc 721 tgGTGGCCTT CTTGGGCTAC AAATATGTCG GGATGATTGG CGGGGTCCTC ATGGGCCTGC 781 TCTTCGGGAA GATTGGCTAC TACCTGGTGC TGGGCTGGTG CTGCGTAGCC ATCTTTGTGT 841 TCATGTTTCC CCTTTTGCCG GGCGCGGTGG CTCATGCTTG TAATCCCAGC ACTTTGGGAG 901 GCCGAGGCGG TCGGATCACG AGGTCAGGAG ATCAAGACCA TCCTGGCTAC CTAACTTTCT 961 TGTACAAAGT GGTTGATATC GGTAAGCCTA TCCCTAACCC TCTCCTCGGT CTCGATTCTA 1021 CGTAGTAATG AACTAGTCCG TAACTTGAAA GTATTTCGAT TTCTTGGCTT TATATATCTT 1081 GTGGAAAGGA CGACGACGAA GTTCTCCGTG TCATCAAACG CGTTAAGTCg acaatcaacc 1141 tctggattac aaaatttgtg aaagatt