Transcript: Mouse NM_030096.2

Mus musculus DEAD (Asp-Glu-Ala-Asp) box polypeptide 52 (Ddx52), mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Ddx52 (78394)
Length:
3180
CDS:
89..1885

Additional Resources:

NCBI RefSeq record:
NM_030096.2
NBCI Gene record:
Ddx52 (78394)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_030096.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000103766 CCTGGTCATCAATTATGATTT pLKO.1 1537 CDS 100% 13.200 18.480 N Ddx52 n/a
2 TRCN0000340417 CTTTAGAGCCCTGGTTATATC pLKO_005 793 CDS 100% 13.200 10.560 N Ddx52 n/a
3 TRCN0000340340 GAGTACTTACAACCATCTTTA pLKO_005 1950 3UTR 100% 13.200 10.560 N Ddx52 n/a
4 TRCN0000052105 GCCATGAGAGAACTTGTTAAA pLKO.1 1295 CDS 100% 13.200 9.240 N DDX52 n/a
5 TRCN0000103765 CCAAACATTTGAAATCCACAA pLKO.1 1971 3UTR 100% 4.050 2.835 N Ddx52 n/a
6 TRCN0000103767 CCAATTCAGATGCAAGCCATT pLKO.1 659 CDS 100% 4.050 2.835 N Ddx52 n/a
7 TRCN0000103769 GCTGCAATAGCAGCTAAGAAA pLKO.1 902 CDS 100% 0.563 0.394 N Ddx52 n/a
8 TRCN0000294198 GCTCATATATGAAGGTATTAA pLKO_005 1384 CDS 100% 15.000 9.000 N DDX52 n/a
9 TRCN0000340443 GCTCATATATGAAGGTATTAA pLKO_005 1384 CDS 100% 15.000 9.000 N Ddx52 n/a
10 TRCN0000103768 CAAGCCAGATTCACAGAGAAT pLKO.1 831 CDS 100% 4.950 2.970 N Ddx52 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_030096.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07737 pDONR223 100% 86% 88.3% None (many diffs) n/a
2 ccsbBroad304_07737 pLX_304 0% 86% 88.3% V5 (many diffs) n/a
Download CSV