Transcript: Mouse NM_030108.2

Mus musculus transmembrane protein 33 (Tmem33), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-06-03
Taxon:
Mus musculus (mouse)
Gene:
Tmem33 (67878)
Length:
5454
CDS:
268..1008

Additional Resources:

NCBI RefSeq record:
NM_030108.2
NBCI Gene record:
Tmem33 (67878)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_030108.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000215397 CTAGATAGAATCCGTTAAATT pLKO.1 3675 3UTR 100% 15.000 21.000 N Tmem33 n/a
2 TRCN0000216503 CTAACGTTGTTCATAACATTT pLKO.1 4518 3UTR 100% 13.200 18.480 N Tmem33 n/a
3 TRCN0000174374 CTGAAATTCATCGCTTGTAAT pLKO.1 736 CDS 100% 13.200 18.480 N Tmem33 n/a
4 TRCN0000320322 CTGAAATTCATCGCTTGTAAT pLKO_005 736 CDS 100% 13.200 18.480 N Tmem33 n/a
5 TRCN0000175560 CGCAAAGGGTTCAAATAGTTT pLKO.1 663 CDS 100% 5.625 7.875 N Tmem33 n/a
6 TRCN0000320321 CGCAAAGGGTTCAAATAGTTT pLKO_005 663 CDS 100% 5.625 7.875 N Tmem33 n/a
7 TRCN0000216557 GATTATGCTGTGCTACTTAAA pLKO.1 3249 3UTR 100% 13.200 9.240 N Tmem33 n/a
8 TRCN0000174919 GCAAAGGGTTCAAATAGTTTA pLKO.1 664 CDS 100% 13.200 9.240 N Tmem33 n/a
9 TRCN0000115926 GCAATTCATGATGACCAATAA pLKO.1 312 CDS 100% 13.200 9.240 N TMEM33 n/a
10 TRCN0000175156 GCAATTCATGATGACCAATAA pLKO.1 312 CDS 100% 13.200 9.240 N Tmem33 n/a
11 TRCN0000320319 GCAATTCATGATGACCAATAA pLKO_005 312 CDS 100% 13.200 9.240 N Tmem33 n/a
12 TRCN0000194565 CCTACCCTGTCACAATGAGTA pLKO.1 581 CDS 100% 4.950 3.465 N Tmem33 n/a
13 TRCN0000173579 GAACTGAGGATTGTGGTTGAA pLKO.1 895 CDS 100% 4.950 3.465 N Tmem33 n/a
14 TRCN0000173377 GCATCAGAGATTACCTCACTT pLKO.1 477 CDS 100% 4.950 3.465 N Tmem33 n/a
15 TRCN0000320244 GCATCAGAGATTACCTCACTT pLKO_005 477 CDS 100% 4.950 3.465 N Tmem33 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_030108.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03539 pDONR223 100% 90.5% 97.1% None (many diffs) n/a
2 ccsbBroad304_03539 pLX_304 0% 90.5% 97.1% V5 (many diffs) n/a
3 TRCN0000469076 GCTCATCATTTATGCTCCGCAGTC pLX_317 51.7% 90.5% 97.1% V5 (many diffs) n/a
Download CSV