Transcript: Mouse NM_030167.4

Mus musculus family with sequence similarity 122, member B (Fam122b), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Fam122b (78755)
Length:
4334
CDS:
833..1603

Additional Resources:

NCBI RefSeq record:
NM_030167.4
NBCI Gene record:
Fam122b (78755)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_030167.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000176941 GCACCTACTTTCAAACATTTA pLKO.1 1882 3UTR 100% 13.200 18.480 N Fam122b n/a
2 TRCN0000181442 CGGCAATTATGAGCCATCATA pLKO.1 984 CDS 100% 0.563 0.788 N Fam122b n/a
3 TRCN0000181272 CCTGTTCTCAATCCAAGACAT pLKO.1 1268 CDS 100% 4.950 3.465 N Fam122b n/a
4 TRCN0000198209 CTGGATATGATGAACAGAGAA pLKO.1 1019 CDS 100% 4.950 3.465 N Fam122b n/a
5 TRCN0000182585 GCGGAGAACTTTGATCCACAA pLKO.1 1664 3UTR 100% 4.050 2.835 N Fam122b n/a
6 TRCN0000182175 CAGTAGTATCAGCAGTGGCTT pLKO.1 1477 CDS 100% 2.640 1.848 N Fam122b n/a
7 TRCN0000129537 CCAGTGTTCTTGGTCCTCTTA pLKO.1 1332 CDS 100% 4.950 2.970 N FAM122B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_030167.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05100 pDONR223 100% 84.3% 82.8% None (many diffs) n/a
2 ccsbBroad304_05100 pLX_304 0% 84.3% 82.8% V5 (many diffs) n/a
3 TRCN0000480791 ACCAACCCCTCGTCAGTCAGCATA pLX_317 49.9% 84.3% 82.8% V5 (many diffs) n/a
Download CSV