Transcript: Mouse NM_030205.4

Mus musculus coronin 7 (Coro7), mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
Coro7 (78885)
Length:
3518
CDS:
110..2878

Additional Resources:

NCBI RefSeq record:
NM_030205.4
NBCI Gene record:
Coro7 (78885)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_030205.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000125694 CCCATAACAAACAGCCTATAT pLKO.1 3421 3UTR 100% 13.200 10.560 N Coro7 n/a
2 TRCN0000125696 GCCTGGTTTGAGGGTGCTAAT pLKO.1 2627 CDS 100% 10.800 7.560 N Coro7 n/a
3 TRCN0000125697 GCTTCCAGTTCCTATGATCTA pLKO.1 1931 CDS 100% 4.950 3.465 N Coro7 n/a
4 TRCN0000125698 TCAGTGATATTCGTGCTGTAA pLKO.1 177 CDS 100% 4.950 3.465 N Coro7 n/a
5 TRCN0000125695 GCATGTAAGGACAAGCAGCTT pLKO.1 665 CDS 100% 2.640 1.848 N Coro7 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_030205.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04084 pDONR223 100% 82.4% 86.2% None (many diffs) n/a
2 ccsbBroad304_04084 pLX_304 0% 82.4% 86.2% V5 (many diffs) n/a
3 TRCN0000468076 TGCCCGAAAGCATGAGTCCCTCTT pLX_317 15.3% 82.4% 86.2% V5 (many diffs) n/a
Download CSV