Transcript: Mouse NM_030215.3

Mus musculus Werner helicase interacting protein 1 (Wrnip1), mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Wrnip1 (78903)
Length:
2642
CDS:
209..2191

Additional Resources:

NCBI RefSeq record:
NM_030215.3
NBCI Gene record:
Wrnip1 (78903)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_030215.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000103762 GCATAAGGTTTGTGACATTAT pLKO.1 1059 CDS 100% 13.200 18.480 N Wrnip1 n/a
2 TRCN0000305741 TAGAGGCAATGGTGACGATTT pLKO_005 1338 CDS 100% 10.800 8.640 N Wrnip1 n/a
3 TRCN0000436158 ATGATGTGCGAGATGTCATAA pLKO_005 1101 CDS 100% 13.200 9.240 N WRNIP1 n/a
4 TRCN0000305743 GGCCCAGTGTGTGGTCTATTT pLKO_005 1924 CDS 100% 13.200 9.240 N Wrnip1 n/a
5 TRCN0000436134 GTGACATTATCTGCAACAAAT pLKO_005 1070 CDS 100% 13.200 9.240 N WRNIP1 n/a
6 TRCN0000103760 CCAGAAATTAAGGGTTCCATA pLKO.1 2297 3UTR 100% 4.950 3.465 N Wrnip1 n/a
7 TRCN0000004525 CTGATGAAGGATTTGGGCTAT pLKO.1 2066 CDS 100% 4.050 2.835 N WRNIP1 n/a
8 TRCN0000103764 GCGGTCAAACCTATTCTCCTA pLKO.1 1587 CDS 100% 2.640 1.848 N Wrnip1 n/a
9 TRCN0000324421 GCGGTCAAACCTATTCTCCTA pLKO_005 1587 CDS 100% 2.640 1.848 N Wrnip1 n/a
10 TRCN0000305742 GGTGGTTACTTCAGCTAAATG pLKO_005 2324 3UTR 100% 13.200 7.920 N Wrnip1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_030215.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000469615 ACATTTTGACAGATCCACTTGCCT pLX_317 16.6% 85.4% 91.1% V5 (many diffs) n/a
Download CSV