Transcript: Mouse NM_030250.2

Mus musculus NUS1 dehydrodolichyl diphosphate synthase subunit (Nus1), mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Nus1 (52014)
Length:
4614
CDS:
196..1089

Additional Resources:

NCBI RefSeq record:
NM_030250.2
NBCI Gene record:
Nus1 (52014)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_030250.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000202366 GATCTGCTAGGCAGCTTACTT pLKO.1 877 CDS 100% 5.625 7.875 N Nus1 n/a
2 TRCN0000246709 CCAGATTGATGGATGAAATTT pLKO_005 644 CDS 100% 15.000 10.500 N Nus1 n/a
3 TRCN0000191490 GACAAAGACGATCAAGATTTA pLKO.1 733 CDS 100% 13.200 9.240 N Nus1 n/a
4 TRCN0000246710 TCTACGACCACCAAGGTATTT pLKO_005 608 CDS 100% 13.200 9.240 N Nus1 n/a
5 TRCN0000246708 TGACAAAGACGATCAAGATTT pLKO_005 732 CDS 100% 13.200 9.240 N Nus1 n/a
6 TRCN0000246707 TCTGCTAGGCAGCTTACTTAG pLKO_005 879 CDS 100% 10.800 7.560 N Nus1 n/a
7 TRCN0000202044 CCCTGGCAAATCAGATTGACT pLKO.1 970 CDS 100% 3.000 2.100 N Nus1 n/a
8 TRCN0000246711 GGTCCTGTGGACAGCACATTA pLKO_005 940 CDS 100% 13.200 7.920 N Nus1 n/a
9 TRCN0000182716 CCTGAGTTCAATTCCCAGCAA pLKO.1 3938 3UTR 100% 2.640 1.320 Y BC028528 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_030250.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04696 pDONR223 100% 88.9% 89.2% None (many diffs) n/a
2 ccsbBroad304_04696 pLX_304 0% 88.9% 89.2% V5 (many diffs) n/a
3 TRCN0000470902 TCTAATCACGCCCGAGCCTTTATC pLX_317 45.1% 88.9% 89.2% V5 (many diffs) n/a
Download CSV