Transcript: Mouse NM_030261.4

Mus musculus sestrin 3 (Sesn3), mRNA.

Source:
NCBI, updated 2017-05-14
Taxon:
Mus musculus (mouse)
Gene:
Sesn3 (75747)
Length:
2158
CDS:
252..1730

Additional Resources:

NCBI RefSeq record:
NM_030261.4
NBCI Gene record:
Sesn3 (75747)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_030261.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000088248 CGGTTCTCTAGTGTCAAAGTA pLKO.1 1827 3UTR 100% 5.625 7.875 N Sesn3 n/a
2 TRCN0000088251 GCGCAGAGCTTTGTTTAACTA pLKO.1 1454 CDS 100% 5.625 7.875 N Sesn3 n/a
3 TRCN0000088249 GCTTGGAATATGTACCACAAA pLKO.1 682 CDS 100% 4.950 6.930 N Sesn3 n/a
4 TRCN0000088252 GCCTTAATGGAAAGGATGAAA pLKO.1 1041 CDS 100% 5.625 3.938 N Sesn3 n/a
5 TRCN0000088250 CCAGTTCTACATGCTGCGTAT pLKO.1 527 CDS 100% 4.050 2.835 N Sesn3 n/a
6 TRCN0000141228 CCCATGAGGATGTTGACACAA pLKO.1 1426 CDS 100% 4.950 3.465 N SESN3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_030261.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13218 pDONR223 100% 57.6% 57.9% None (many diffs) n/a
2 ccsbBroad304_13218 pLX_304 0% 57.6% 57.9% V5 (many diffs) n/a
3 TRCN0000473047 ATGGACTATCATGTATGCTTCAAC pLX_317 45% 57.6% 57.9% V5 (many diffs) n/a
Download CSV