Transcript: Mouse NM_030265.3

Mus musculus Kv channel interacting protein 4 (Kcnip4), transcript variant 4, mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
Kcnip4 (80334)
Length:
2188
CDS:
93..782

Additional Resources:

NCBI RefSeq record:
NM_030265.3
NBCI Gene record:
Kcnip4 (80334)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_030265.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000069732 CGTTACCATAGATGAGTTCAT pLKO.1 698 CDS 100% 4.950 6.930 N Kcnip4 n/a
2 TRCN0000044542 CCCAGTGGTGTTGTTAATGAA pLKO.1 324 CDS 100% 5.625 3.938 N KCNIP4 n/a
3 TRCN0000044539 GTTACCATAGATGAGTTCATT pLKO.1 699 CDS 100% 5.625 3.938 N KCNIP4 n/a
4 TRCN0000069729 CCAGAGCAAATTCACCAAGAA pLKO.1 263 CDS 100% 4.950 3.465 N Kcnip4 n/a
5 TRCN0000069730 GAAGAAACTTTCAAGGAGATT pLKO.1 342 CDS 100% 4.950 3.465 N Kcnip4 n/a
6 TRCN0000069728 GCTGGACATAATGAAAGCAAT pLKO.1 572 CDS 100% 4.950 3.465 N Kcnip4 n/a
7 TRCN0000069731 GAGGATTTCATCAAAGGTCTT pLKO.1 456 CDS 100% 4.050 2.835 N Kcnip4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_030265.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09030 pDONR223 100% 78.4% 80.8% None (many diffs) n/a
2 ccsbBroad304_09030 pLX_304 0% 78.4% 80.8% V5 (many diffs) n/a
3 TRCN0000474912 GATGACTATTTTGACTTTCTTTCT pLX_317 24.1% 78.4% 80.8% V5 (many diffs) n/a
Download CSV