Construct: ORF TRCN0000474912
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF017704.1_s317c1
- Derived from:
- ccsbBroadEn_09030
- DNA Barcode:
- GATGACTATTTTGACTTTCTTTCT
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- KCNIP4 (80333)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000474912
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 80333 | KCNIP4 | potassium voltage-gated cha... | NM_025221.6 | 99.6% | 100% | 10A>C;210T>C;288T>C |
| 2 | human | 80333 | KCNIP4 | potassium voltage-gated cha... | NM_147181.3 | 86% | 86% | (many diffs) |
| 3 | human | 80333 | KCNIP4 | potassium voltage-gated cha... | NM_001363504.1 | 84.8% | 80.4% | (many diffs) |
| 4 | human | 80333 | KCNIP4 | potassium voltage-gated cha... | NM_147183.3 | 84.6% | 80.8% | (many diffs) |
| 5 | human | 80333 | KCNIP4 | potassium voltage-gated cha... | NM_001035003.1 | 83.6% | 78.8% | (many diffs) |
| 6 | human | 80333 | KCNIP4 | potassium voltage-gated cha... | XM_011513885.3 | 79.4% | 70.1% | (many diffs) |
| 7 | human | 80333 | KCNIP4 | potassium voltage-gated cha... | NM_001035004.1 | 74.9% | 75.2% | 0_1ins186;24T>C;102T>C |
| 8 | human | 80333 | KCNIP4 | potassium voltage-gated cha... | NM_147182.3 | 74.9% | 75.2% | 0_1ins186;24T>C;102T>C |
| 9 | human | 80333 | KCNIP4 | potassium voltage-gated cha... | XM_017008653.1 | 74.9% | 75.2% | 0_1ins186;24T>C;102T>C |
| 10 | human | 80333 | KCNIP4 | potassium voltage-gated cha... | XM_011513887.2 | 70.9% | 66.7% | (many diffs) |
| 11 | mouse | 80334 | Kcnip4 | Kv channel interacting prot... | NM_001199242.1 | 92.2% | 99.6% | (many diffs) |
| 12 | mouse | 80334 | Kcnip4 | Kv channel interacting prot... | NM_001199243.1 | 79% | 86% | (many diffs) |
| 13 | mouse | 80334 | Kcnip4 | Kv channel interacting prot... | NM_001199244.1 | 78.5% | 78.8% | (many diffs) |
| 14 | mouse | 80334 | Kcnip4 | Kv channel interacting prot... | NM_030265.3 | 78.4% | 80.8% | (many diffs) |
| 15 | mouse | 80334 | Kcnip4 | Kv channel interacting prot... | NM_001199245.1 | 77.9% | 80.4% | (many diffs) |
| 16 | mouse | 80334 | Kcnip4 | Kv channel interacting prot... | XM_017321178.1 | 68.8% | 75.2% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 816
- ORF length:
- 750
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgaa tgtgcggagg gtggaaagca tttcggctca gctggaggag gccagctcta 121 caggcggttt cctgtacgct cagaacagca ccaagcgcag cattaaagag cggctcatga 181 agctcttgcc ctgctcagct gccaaaacgt cgtctcctgc tattcaaaac agcgtggaag 241 atgaactgga gatggccacc gtcaggcatc ggcccgaagc ccttgagctt ctggaagccc 301 agagcaaatt taccaagaaa gagcttcaga tcctttacag aggatttaag aacgaatgcc 361 ccagtggtgt tgttaatgaa gaaaccttca aagagattta ctcgcagttc tttccacagg 421 gagactctac aacatatgca cattttctgt tcaatgcatt tgatacagac cacaatggag 481 ctgtgagttt cgaggatttc atcaaaggtc tttccatttt gctccggggg acagtacaag 541 aaaaactcaa ttgggcattt aatctgtatg acataaataa agatggctac atcactaaag 601 aggaaatgct tgatataatg aaagcaatat acgatatgat GGGTAAATGT ACATATCCTG 661 TCCTCAAAGA AGATGCTCCC AGACAACACG TTGAAACATT TTTTCAGAAA ATGGACAAAA 721 ATAAAGATGG GGTTGTTACC ATAGATGAGT TCATTGAAAG CTGCCAAAAA GATGAAAACA 781 TAATGCGCTC CATGCAGCTC TTTGAAAATG TGATTTACCC AACTTTCTTG TACAAAGTGG 841 TTGATATCGG TAAGCCTATC CCTAACCCTC TCCTCGGTCT CGATTCTACG TAGTAATGAA 901 CTAGTCCGTA ACTTGAAAGT ATTTCGATTT CTTGGCTTTA TATATCTTGT GGAAAGGACG 961 AGATGACTAT TTTGACTTTC TTTCTACGCG TTAAGTCgac aatcaacctc tggattacaa 1021 aatttgtgaa agatt