Transcript: Human NM_030576.4

Homo sapiens LIM domain containing 2 (LIMD2), mRNA.

Source:
NCBI, updated 2019-05-02
Taxon:
Homo sapiens (human)
Gene:
LIMD2 (80774)
Length:
3192
CDS:
145..528

Additional Resources:

NCBI RefSeq record:
NM_030576.4
NBCI Gene record:
LIMD2 (80774)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_030576.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000433027 CCTCTACCCTTAACCTGTTTC pLKO_005 932 3UTR 100% 10.800 7.560 N LIMD2 n/a
2 TRCN0000155877 CAGCAGCTGTTTAAGAGCAAA pLKO.1 421 CDS 100% 4.950 3.465 N LIMD2 n/a
3 TRCN0000155402 CCACAGTTCCACAATAACCAT pLKO.1 2876 3UTR 100% 3.000 2.100 N LIMD2 n/a
4 TRCN0000438276 AGCACTGTCACACCAAGCTCA pLKO_005 347 CDS 100% 2.640 1.848 N LIMD2 n/a
5 TRCN0000156702 CCAGCAGCTGTTTAAGAGCAA pLKO.1 420 CDS 100% 2.640 1.848 N LIMD2 n/a
6 TRCN0000155175 GCTGTTTAAGAGCAAAGGCAA pLKO.1 426 CDS 100% 2.640 1.848 N LIMD2 n/a
7 TRCN0000421326 TCCACAACTCTTGCTTCTGCT pLKO_005 323 CDS 100% 2.640 1.848 N LIMD2 n/a
8 TRCN0000155381 CTGTTTAAGAGCAAAGGCAAC pLKO.1 427 CDS 100% 2.250 1.575 N LIMD2 n/a
9 TRCN0000156263 CAACTCTTGCTTCTGCTGCAA pLKO.1 327 CDS 100% 2.640 1.584 N LIMD2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_030576.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04223 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_04223 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000466800 CTACGCCTAACAATAGCTAGTCAG pLX_317 68.5% 100% 100% V5 n/a
Download CSV