Transcript: Human NM_030578.4

Homo sapiens B9 domain containing 2 (B9D2), mRNA.

Source:
NCBI, updated 2019-08-22
Taxon:
Homo sapiens (human)
Gene:
B9D2 (80776)
Length:
1007
CDS:
197..724

Additional Resources:

NCBI RefSeq record:
NM_030578.4
NBCI Gene record:
B9D2 (80776)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_030578.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000257022 CAGCTTGCAGGCTATGGATTT pLKO_005 464 CDS 100% 10.800 8.640 N B9D2 n/a
2 TRCN0000244801 CTTCGCCACCAAAGGTCTTCA pLKO_005 388 CDS 100% 4.950 3.960 N B9D2 n/a
3 TRCN0000244803 CCAGCGGTTTCTCGGAAAGTA pLKO_005 234 CDS 100% 5.625 3.938 N B9D2 n/a
4 TRCN0000244800 GCACCGCTTCTGTCCTTTCTA pLKO_005 847 3UTR 100% 5.625 3.938 N B9D2 n/a
5 TRCN0000244802 AGAACAGTTGGCACGGGCTTT pLKO_005 556 CDS 100% 4.050 2.430 N B9D2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_030578.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09049 pDONR223 100% 99.8% 99.4% None 33A>G n/a
2 ccsbBroad304_09049 pLX_304 0% 99.8% 99.4% V5 33A>G n/a
3 TRCN0000472977 GAGCAGCCAAATAGGCTGCGAAAT pLX_317 67.1% 99.8% 99.4% V5 33A>G n/a
Download CSV