Transcript: Human NM_030666.4

Homo sapiens serpin family B member 1 (SERPINB1), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-06
Taxon:
Homo sapiens (human)
Gene:
SERPINB1 (1992)
Length:
2476
CDS:
61..1200

Additional Resources:

NCBI RefSeq record:
NM_030666.4
NBCI Gene record:
SERPINB1 (1992)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_030666.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000003711 CTAGGTGTGCAGGATCTCTTT pLKO.1 931 CDS 100% 4.950 3.960 N SERPINB1 n/a
2 TRCN0000277897 CTAGGTGTGCAGGATCTCTTT pLKO_005 931 CDS 100% 4.950 3.960 N SERPINB1 n/a
3 TRCN0000003710 GCATGTCAGGAGCCAGAGATA pLKO.1 977 CDS 100% 4.950 3.465 N SERPINB1 n/a
4 TRCN0000277898 GCATGTCAGGAGCCAGAGATA pLKO_005 977 CDS 100% 4.950 3.465 N SERPINB1 n/a
5 TRCN0000003713 TAGTGCTTTATTACCTGAGTT pLKO.1 1235 3UTR 100% 4.950 3.465 N SERPINB1 n/a
6 TRCN0000277875 TAGTGCTTTATTACCTGAGTT pLKO_005 1235 3UTR 100% 4.950 3.465 N SERPINB1 n/a
7 TRCN0000003709 TGGAGCGTCTTATATTCTGAA pLKO.1 300 CDS 100% 4.950 3.465 N SERPINB1 n/a
8 TRCN0000277876 TGGAGCGTCTTATATTCTGAA pLKO_005 300 CDS 100% 4.950 3.465 N SERPINB1 n/a
9 TRCN0000003712 ACTTTCCATTTCAACACGGTT pLKO.1 229 CDS 100% 2.640 1.848 N SERPINB1 n/a
10 TRCN0000277874 ACTTTCCATTTCAACACGGTT pLKO_005 229 CDS 100% 2.640 1.848 N SERPINB1 n/a
11 TRCN0000172742 GAGACAGAGTCTTGCTCTGTT pLKO.1 2002 3UTR 100% 0.495 0.248 Y C11orf44 n/a
12 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 2241 3UTR 100% 5.625 2.813 Y KLHL30 n/a
13 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 2241 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_030666.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06153 pDONR223 100% 99.9% 99.7% None 14G>A n/a
2 ccsbBroad304_06153 pLX_304 0% 99.9% 99.7% V5 14G>A n/a
3 TRCN0000480924 ATAAAAGACTAGCGTCTTGTAACA pLX_317 36.3% 99.9% 99.7% V5 14G>A n/a
Download CSV