Transcript: Human NM_030671.3

Homo sapiens protein tyrosine phosphatase receptor type O (PTPRO), transcript variant 5, mRNA.

Source:
NCBI, updated 2019-07-28
Taxon:
Homo sapiens (human)
Gene:
PTPRO (5800)
Length:
4735
CDS:
228..1445

Additional Resources:

NCBI RefSeq record:
NM_030671.3
NBCI Gene record:
PTPRO (5800)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_030671.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000342463 ATGTGGCCAAGGAGATAATTT pLKO_005 2589 3UTR 100% 15.000 10.500 N PTPRO n/a
2 TRCN0000342520 GCCAAAGACTCTGACTATAAA pLKO_005 585 CDS 100% 15.000 10.500 N PTPRO n/a
3 TRCN0000367385 AGTGGGCCCTGATGGTCATTT pLKO_005 2541 3UTR 100% 13.200 9.240 N PTPRO n/a
4 TRCN0000002901 GTTGCTTGTTACCCTCATTAT pLKO.1 302 CDS 100% 13.200 9.240 N PTPRO n/a
5 TRCN0000002902 GCCTGTTACTTTGTGTCACTT pLKO.1 3688 3UTR 100% 4.950 3.465 N PTPRO n/a
6 TRCN0000342464 GATGACTTTGATGCCTATATT pLKO_005 555 CDS 100% 15.000 9.000 N PTPRO n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_030671.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01345 pDONR223 100% 33.3% 33.3% None 0_1ins2433 n/a
2 ccsbBroad304_01345 pLX_304 0% 33.3% 33.3% V5 0_1ins2433 n/a
3 TRCN0000477482 ATTAACTGTCTATCAACCTAGATC pLX_317 13% 33.3% 33.3% V5 0_1ins2433 n/a
Download CSV