Transcript: Mouse NM_030688.2

Mus musculus interleukin 1 receptor accessory protein-like 2 (Il1rapl2), mRNA.

Source:
NCBI, updated 2017-06-10
Taxon:
Mus musculus (mouse)
Gene:
Il1rapl2 (60367)
Length:
5422
CDS:
909..2969

Additional Resources:

NCBI RefSeq record:
NM_030688.2
NBCI Gene record:
Il1rapl2 (60367)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_030688.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000066608 CGGCTACAGTGAGAATAAATT pLKO.1 3024 3UTR 100% 15.000 21.000 N Il1rapl2 n/a
2 TRCN0000426140 GTGCTAACTCCAGACTATATT pLKO_005 2325 CDS 100% 15.000 21.000 N IL1RAPL2 n/a
3 TRCN0000066612 GACGACTTATTATCGTGCTAA pLKO.1 2311 CDS 100% 4.950 6.930 N Il1rapl2 n/a
4 TRCN0000066609 CCAATGATCTACTGGATGAAA pLKO.1 1737 CDS 100% 5.625 4.500 N Il1rapl2 n/a
5 TRCN0000066610 GCTTAGCTTCACCAGTGATAT pLKO.1 2942 CDS 100% 13.200 9.240 N Il1rapl2 n/a
6 TRCN0000066611 CCTGTGCTACAATAGCAGGAT pLKO.1 1325 CDS 100% 2.640 1.848 N Il1rapl2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_030688.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02951 pDONR223 100% 91.7% 94.4% None (many diffs) n/a
2 ccsbBroad304_02951 pLX_304 0% 91.7% 94.4% V5 (many diffs) n/a
3 TRCN0000476821 GCACAATATTAATATTCAAATAAT pLX_317 18% 91.7% 94.4% V5 (many diffs) n/a
Download CSV