Transcript: Mouse NM_030736.2

Mus musculus vomeronasal 1 receptor 148 (Vmn1r148), mRNA.

Source:
NCBI, updated 2014-01-15
Taxon:
Mus musculus (mouse)
Gene:
Vmn1r148 (81011)
Length:
2439
CDS:
1353..2276

Additional Resources:

NCBI RefSeq record:
NM_030736.2
NBCI Gene record:
Vmn1r148 (81011)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_030736.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000250170 CAGAGCAAGTGTCCCAAATTT pLKO_005 1742 CDS 100% 15.000 7.500 Y Vmn1r93 n/a
2 TRCN0000272280 GACTCTATTCCTCACTATATT pLKO_005 1544 CDS 100% 15.000 7.500 Y Vmn1r132 n/a
3 TRCN0000250171 TAACATCCACATTCCAATTAA pLKO_005 1808 CDS 100% 15.000 7.500 Y Vmn1r93 n/a
4 TRCN0000420054 TCTTTCTGTTTGTCCATAATT pLKO_005 1447 CDS 100% 15.000 7.500 Y Vmn1r148 n/a
5 TRCN0000193299 CCAACTGAACTCAAATGTAAA pLKO.1 1602 CDS 100% 13.200 6.600 Y Vmn1r93 n/a
6 TRCN0000430457 CTCCTCCAACTGAACTCAAAT pLKO_005 1597 CDS 100% 13.200 6.600 Y Vmn1r148 n/a
7 TRCN0000174920 GACAATAACACTGACTCTAAA pLKO.1 1851 CDS 100% 13.200 6.600 Y Vmn1r148 n/a
8 TRCN0000216455 GTAACATCCACATTCCAATTA pLKO.1 1807 CDS 100% 13.200 6.600 Y Gm5728 n/a
9 TRCN0000126886 GTCACTCTTGTTCCTGTTAAT pLKO.1 1698 CDS 100% 13.200 6.600 Y Vmn1r180 n/a
10 TRCN0000203053 GTCTTTCTGTTTGTCCATAAT pLKO.1 1446 CDS 100% 13.200 6.600 Y Vmn1r122 n/a
11 TRCN0000414282 TCAGAGCAAGTGTCCCAAATT pLKO_005 1741 CDS 100% 13.200 6.600 Y Vmn1r148 n/a
12 TRCN0000272281 ACCAGAGCAACCCATACTATC pLKO_005 2058 CDS 100% 10.800 5.400 Y Vmn1r132 n/a
13 TRCN0000425110 CAGTCTTGACTGGTTCTAAAC pLKO_005 1474 CDS 100% 10.800 5.400 Y Vmn1r148 n/a
14 TRCN0000174845 GTTCCTGTTAATAGAGGTAAA pLKO.1 1707 CDS 100% 10.800 5.400 Y Vmn1r148 n/a
15 TRCN0000272283 TTCCTGTTAATAGAGGTAAAG pLKO_005 1708 CDS 100% 10.800 5.400 Y Vmn1r132 n/a
16 TRCN0000125257 CCTCACTATATTTCCAAACAA pLKO.1 1553 CDS 100% 5.625 2.813 Y V1rd19 n/a
17 TRCN0000186233 CTGTTCCACTTCTGGATTCAT pLKO.1 1883 CDS 100% 5.625 2.813 Y Vmn1r151 n/a
18 TRCN0000125375 CCATAATTTCTCTCCAGTCTT pLKO.1 1460 CDS 100% 4.950 2.475 Y Vmn1r59 n/a
19 TRCN0000188142 CCATCAGTTTGTCACTCTTGT pLKO.1 1688 CDS 100% 4.950 2.475 Y Vmn1r159 n/a
20 TRCN0000174325 CGAATTATTCTTGCTACAGTT pLKO.1 1765 CDS 100% 4.950 2.475 Y Vmn1r148 n/a
21 TRCN0000187107 CTTGACTCTATTCCTCACTAT pLKO.1 1541 CDS 100% 4.950 2.475 Y Vmn1r159 n/a
22 TRCN0000194119 GTACTTCTCCTCCATAGACAT pLKO.1 1980 CDS 100% 4.950 2.475 Y V1rd19 n/a
23 TRCN0000185270 GTCTTAAGTAACATCCACATT pLKO.1 1800 CDS 100% 4.950 2.475 Y Vmn1r151 n/a
24 TRCN0000126501 GTGGTCACATTTGTTAGCTTT pLKO.1 2088 CDS 100% 4.950 2.475 Y Vmn1r183 n/a
25 TRCN0000193465 GTGGTCACATTTGTTAGCTTT pLKO.1 2088 CDS 100% 4.950 2.475 Y Vmn1r178 n/a
26 TRCN0000186527 GTTCTGTTCCACTTCTGGATT pLKO.1 1880 CDS 100% 4.950 2.475 Y Gm5725 n/a
27 TRCN0000189046 GCCTTGACTCTATTCCTCACT pLKO.1 1539 CDS 100% 2.640 1.320 Y Vmn1r159 n/a
28 TRCN0000193932 CCAGTCTTGACTGGTTCTAAA pLKO.1 1473 CDS 100% 1.320 0.660 Y Vmn1r178 n/a
29 TRCN0000176021 GTTGATCTTCAGAGATCCTAA pLKO.1 2225 CDS 100% 0.495 0.248 Y Vmn1r148 n/a
30 TRCN0000202548 CAGTTTGTCACTCTTGTTCTT pLKO.1 1692 CDS 100% 4.950 2.475 Y Vmn1r151 n/a
31 TRCN0000203741 CATCCTCACTCCCAATCAGAA pLKO.1 2018 CDS 100% 4.950 2.475 Y Vmn1r122 n/a
32 TRCN0000187324 CATCCTCACTCCCAATCAGTA pLKO.1 2018 CDS 100% 4.950 2.475 Y Vmn1r151 n/a
33 TRCN0000187400 CCTTGACTCTATTCCTCACAA pLKO.1 1540 CDS 100% 4.950 2.475 Y Vmn1r113 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_030736.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.