Transcript: Human NM_030783.3

Homo sapiens phosphatidylserine synthase 2 (PTDSS2), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-05-02
Taxon:
Homo sapiens (human)
Gene:
PTDSS2 (81490)
Length:
2458
CDS:
178..1641

Additional Resources:

NCBI RefSeq record:
NM_030783.3
NBCI Gene record:
PTDSS2 (81490)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_030783.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000257416 GCCGGCAGTTTCTAAAGTATG pLKO_005 626 CDS 100% 10.800 15.120 N PTDSS2 n/a
2 TRCN0000045799 GCGTGAGATCTACGACTTCAT pLKO.1 1263 CDS 100% 4.950 6.930 N PTDSS2 n/a
3 TRCN0000045800 CAAGCTAAAGACGGGCCATTT pLKO.1 508 CDS 100% 10.800 8.640 N PTDSS2 n/a
4 TRCN0000229306 CAAGCTAAAGACGGGCCATTT pLKO_005 508 CDS 100% 10.800 8.640 N PTDSS2 n/a
5 TRCN0000350003 CAAGCTAAAGACGGGCCATTT pLKO_005 508 CDS 100% 10.800 8.640 N Ptdss2 n/a
6 TRCN0000229307 ACGAGCTGTTTCTCATCTTTA pLKO_005 581 CDS 100% 13.200 9.240 N PTDSS2 n/a
7 TRCN0000218416 TACAACACCAAGAGAGGTATT pLKO_005 448 CDS 100% 10.800 7.560 N PTDSS2 n/a
8 TRCN0000045798 CGGCAGTTTCTAAAGTATGTT pLKO.1 628 CDS 100% 5.625 3.938 N PTDSS2 n/a
9 TRCN0000229308 CTCCATGTGTACACGTGTGTA pLKO_005 1817 3UTR 100% 4.950 3.465 N PTDSS2 n/a
10 TRCN0000045802 CCACACCTTAACCGTGCTCTT pLKO.1 366 CDS 100% 4.050 2.835 N PTDSS2 n/a
11 TRCN0000045801 GTACCTGAAGACCCTGATGAT pLKO.1 789 CDS 100% 0.000 0.000 N PTDSS2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_030783.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.