Transcript: Human NM_030786.3

Homo sapiens syncoilin, intermediate filament protein (SYNC), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-05-17
Taxon:
Homo sapiens (human)
Gene:
SYNC (81493)
Length:
3503
CDS:
111..1559

Additional Resources:

NCBI RefSeq record:
NM_030786.3
NBCI Gene record:
SYNC (81493)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_030786.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000430171 TGAAGAGCTCTCTACTTATAA pLKO_005 1448 CDS 100% 15.000 10.500 N SYNC n/a
2 TRCN0000426596 CAGTCACAAGGGCGGAGAAAT pLKO_005 535 CDS 100% 13.200 9.240 N SYNC n/a
3 TRCN0000414801 ACCTTGATGAGACACTCTATG pLKO_005 307 CDS 100% 10.800 7.560 N SYNC n/a
4 TRCN0000127890 CCAGAAACTTGGCAAGCAATT pLKO.1 1660 3UTR 100% 10.800 7.560 N SYNC n/a
5 TRCN0000130939 CAGCTGGAGGAAATGGAAGAA pLKO.1 1347 CDS 100% 4.950 3.465 N SYNC n/a
6 TRCN0000129495 GCCAAATCTGTAACCCGGAAA pLKO.1 1569 3UTR 100% 4.050 2.835 N SYNC n/a
7 TRCN0000128140 CAGAAGAACAAAGAGATGGAA pLKO.1 1407 CDS 100% 3.000 2.100 N SYNC n/a
8 TRCN0000129526 GAAATGAAGGAGGCTCTGAGA pLKO.1 1218 CDS 100% 2.640 1.848 N SYNC n/a
9 TRCN0000131230 GAACAGCTGGAGGAAATGGAA pLKO.1 1344 CDS 100% 3.000 1.800 N SYNC n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_030786.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12715 pDONR223 100% 31.3% 31.3% None 1_993del n/a
2 ccsbBroad304_12715 pLX_304 0% 31.3% 31.3% V5 1_993del n/a
3 TRCN0000468318 GAAAACGACCACTGAGCGTGTTCA pLX_317 88.8% 31.3% 31.3% V5 1_993del n/a
Download CSV