Transcript: Human NM_030965.3

Homo sapiens ST6 N-acetylgalactosaminide alpha-2,6-sialyltransferase 5 (ST6GALNAC5), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-07
Taxon:
Homo sapiens (human)
Gene:
ST6GALNAC5 (81849)
Length:
5547
CDS:
197..1207

Additional Resources:

NCBI RefSeq record:
NM_030965.3
NBCI Gene record:
ST6GALNAC5 (81849)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_030965.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000035090 GAGTGTGTCATCCGCATGAAT pLKO.1 548 CDS 100% 5.625 7.875 N ST6GALNAC5 n/a
2 TRCN0000035092 CGGACATTCAATATTCACTTT pLKO.1 1121 CDS 100% 4.950 3.960 N ST6GALNAC5 n/a
3 TRCN0000414822 GCCTTTGAAACTGCAACATAA pLKO_005 1503 3UTR 100% 13.200 9.240 N ST6GALNAC5 n/a
4 TRCN0000035089 GCTATAAATCATCCTGAGAAT pLKO.1 1172 CDS 100% 4.950 3.465 N ST6GALNAC5 n/a
5 TRCN0000035093 TGGCTGGTTTACAATGACAAT pLKO.1 895 CDS 100% 4.950 3.465 N ST6GALNAC5 n/a
6 TRCN0000437387 GGCAGTCATCACCGCTTTATC pLKO_005 1070 CDS 100% 13.200 7.920 N ST6GALNAC5 n/a
7 TRCN0000035091 GAAACCAGAATCACTTGCTAT pLKO.1 1156 CDS 100% 4.950 2.970 N ST6GALNAC5 n/a
8 TRCN0000166364 CACACACACACACACACACAA pLKO.1 2419 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_030965.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04258 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_04258 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000466231 GACTTACACAGACTGATTATAATA pLX_317 40.6% 100% 100% V5 n/a
Download CSV