Transcript: Human NM_030978.3

Homo sapiens actin related protein 2/3 complex subunit 5 like (ARPC5L), mRNA.

Source:
NCBI, updated 2019-07-06
Taxon:
Homo sapiens (human)
Gene:
ARPC5L (81873)
Length:
2507
CDS:
1253..1714

Additional Resources:

NCBI RefSeq record:
NM_030978.3
NBCI Gene record:
ARPC5L (81873)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_030978.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000150194 GCGTTGACTTGTTAATGAAGT pLKO.1 1563 CDS 100% 4.950 6.930 N ARPC5L n/a
2 TRCN0000312457 GCGTTGACTTGTTAATGAAGT pLKO_005 1563 CDS 100% 4.950 6.930 N ARPC5L n/a
3 TRCN0000100311 GCTCCATTATAAGAGTTCTTA pLKO.1 1674 CDS 100% 5.625 3.938 N Arpc5l n/a
4 TRCN0000146953 CTTACAGCAAGAAAGACTGTT pLKO.1 1691 CDS 100% 4.950 3.465 N ARPC5L n/a
5 TRCN0000147550 GATCTGATAGTCTATGCCTTT pLKO.1 1901 3UTR 100% 4.050 2.835 N ARPC5L n/a
6 TRCN0000312407 GATCTGATAGTCTATGCCTTT pLKO_005 1901 3UTR 100% 4.050 2.835 N ARPC5L n/a
7 TRCN0000147584 GTCTGTTTCCTAAATCCTGTT pLKO.1 1877 3UTR 100% 4.050 2.835 N ARPC5L n/a
8 TRCN0000312406 GTCTGTTTCCTAAATCCTGTT pLKO_005 1877 3UTR 100% 4.050 2.835 N ARPC5L n/a
9 TRCN0000147583 GAAAGTGCTCACAAACTTCAA pLKO.1 1498 CDS 100% 4.950 2.970 N ARPC5L n/a
10 TRCN0000312405 GAAAGTGCTCACAAACTTCAA pLKO_005 1498 CDS 100% 4.950 2.970 N ARPC5L n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_030978.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.