Transcript: Mouse NM_031199.4

Mus musculus transforming growth factor alpha (Tgfa), mRNA.

Source:
NCBI, updated 2017-06-10
Taxon:
Mus musculus (mouse)
Gene:
Tgfa (21802)
Length:
4547
CDS:
280..759

Additional Resources:

NCBI RefSeq record:
NM_031199.4
NBCI Gene record:
Tgfa (21802)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_031199.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000313254 TCGTCAGGATGCGTGTCTTAT pLKO_005 1231 3UTR 100% 13.200 18.480 N Tgfa n/a
2 TRCN0000313255 TTCCATGGAACCTGCCGGTTT pLKO_005 442 CDS 100% 4.050 5.670 N Tgfa n/a
3 TRCN0000088427 CACTCTGGGTACGTGGGTGTT pLKO.1 496 CDS 100% 1.350 1.890 N Tgfa n/a
4 TRCN0000313257 CTTCAACAAGTGCCCAGATTC pLKO_005 405 CDS 100% 10.800 7.560 N Tgfa n/a
5 TRCN0000313256 TAGCGCTGGGTATCCTGTTAG pLKO_005 311 CDS 100% 10.800 7.560 N Tgfa n/a
6 TRCN0000088424 ACTTCAACAAGTGCCCAGATT pLKO.1 404 CDS 100% 4.950 3.465 N Tgfa n/a
7 TRCN0000088426 CCACTGCTGTCAGCTCCGCAA pLKO.1 639 CDS 100% 0.000 0.000 N Tgfa n/a
8 TRCN0000312199 CCACTGCTGTCAGCTCCGCAA pLKO_005 639 CDS 100% 0.000 0.000 N Tgfa n/a
9 TRCN0000088423 CCCTTTAATAATGTTGGCATT pLKO.1 1790 3UTR 100% 4.050 2.430 N Tgfa n/a
10 TRCN0000369163 CCAGATTCCCACACTCAGTTC pLKO_005 418 CDS 100% 4.050 2.835 N TGFA n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_031199.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01664 pDONR223 100% 88.4% 92.4% None (many diffs) n/a
2 ccsbBroad304_01664 pLX_304 0% 88.4% 92.4% V5 (many diffs) n/a
3 TRCN0000471784 ACACGTAACCAGGCTGCGGTGGCG pLX_317 100% 88.4% 92.4% V5 (many diffs) n/a
Download CSV