Transcript: Human NM_031209.3

Homo sapiens queuine tRNA-ribosyltransferase catalytic subunit 1 (QTRT1), mRNA.

Source:
NCBI, updated 2019-08-07
Taxon:
Homo sapiens (human)
Gene:
QTRT1 (81890)
Length:
1329
CDS:
23..1234

Additional Resources:

NCBI RefSeq record:
NM_031209.3
NBCI Gene record:
QTRT1 (81890)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_031209.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000443296 TTTCCAGATGGTGTCGCTGGT pLKO_005 346 CDS 100% 2.160 3.024 N QTRT1 n/a
2 TRCN0000436225 CAACGGTCTCCACGGCTTCAT pLKO_005 289 CDS 100% 1.650 2.310 N QTRT1 n/a
3 TRCN0000034953 GCCTCATAATCTGCTAACGGA pLKO.1 316 CDS 100% 0.750 1.050 N QTRT1 n/a
4 TRCN0000034952 GCAGAACCTCTTCGCCATTAT pLKO.1 604 CDS 100% 13.200 9.240 N QTRT1 n/a
5 TRCN0000437019 GAGGCCATGTACAGGTCAATC pLKO_005 539 CDS 100% 10.800 7.560 N QTRT1 n/a
6 TRCN0000034950 GCTTCATGAATTGGCCTCATA pLKO.1 303 CDS 100% 4.950 3.465 N QTRT1 n/a
7 TRCN0000421887 AGGTGTTTGAGAAGGACTTCG pLKO_005 933 CDS 100% 4.050 2.835 N QTRT1 n/a
8 TRCN0000437324 TGCCACTGATCTGGTAGTCTG pLKO_005 811 CDS 100% 4.050 2.835 N QTRT1 n/a
9 TRCN0000446981 ATCCAGAAAGCCAACGGTCTC pLKO_005 278 CDS 100% 2.250 1.575 N QTRT1 n/a
10 TRCN0000034949 CCCGGAGAAATCCGTGCAGAT pLKO.1 439 CDS 100% 1.350 0.945 N QTRT1 n/a
11 TRCN0000034951 GCAGTTGAGGAAGAAGGTGTT pLKO.1 919 CDS 100% 4.050 2.430 N QTRT1 n/a
12 TRCN0000110402 CCGGACAAGCAGAACCTCTTT pLKO.1 596 CDS 100% 4.950 3.465 N Qtrt1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_031209.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12733 pDONR223 100% 88.8% 88.8% None 1_135del n/a
2 ccsbBroad304_12733 pLX_304 0% 88.8% 88.8% V5 1_135del n/a
3 TRCN0000468041 GGGCTATTTTATTCCAACGTCGGT pLX_317 39.9% 88.8% 88.8% V5 1_135del n/a
Download CSV