Transcript: Mouse NM_031258.3

Mus musculus chordin-like 1 (Chrdl1), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-05-21
Taxon:
Mus musculus (mouse)
Gene:
Chrdl1 (83453)
Length:
4190
CDS:
525..1526

Additional Resources:

NCBI RefSeq record:
NM_031258.3
NBCI Gene record:
Chrdl1 (83453)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_031258.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000180417 GCAGCACCTAAGAGATCATTA pLKO.1 3067 3UTR 100% 13.200 18.480 N Chrdl1 n/a
2 TRCN0000180710 GCGAATACAATGGAACCACTT pLKO.1 853 CDS 100% 4.050 5.670 N Chrdl1 n/a
3 TRCN0000179750 CGTGCAGATTGTCATCAATAA pLKO.1 1244 CDS 100% 13.200 9.240 N Chrdl1 n/a
4 TRCN0000184201 GCACCCAAATCTACGAGCATT pLKO.1 1328 CDS 100% 4.950 3.465 N Chrdl1 n/a
5 TRCN0000180758 GCAGAATTATCGTGGGAACAT pLKO.1 1053 CDS 100% 4.950 3.465 N Chrdl1 n/a
6 TRCN0000183809 CCATTCATTCTAATGGCATTT pLKO.1 2184 3UTR 100% 1.080 0.756 N Chrdl1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_031258.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04563 pDONR223 100% 65.5% 65.7% None (many diffs) n/a
2 ccsbBroad304_04563 pLX_304 0% 65.5% 65.7% V5 (many diffs) n/a
3 TRCN0000477772 TGTGGTCCGCAAAAGACCAATAAG pLX_317 20.2% 65.5% 65.7% V5 (many diffs) n/a
Download CSV