Transcript: Mouse NM_031404.4

Mus musculus actin-like 6B (Actl6b), mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
Actl6b (83766)
Length:
1577
CDS:
81..1361

Additional Resources:

NCBI RefSeq record:
NM_031404.4
NBCI Gene record:
Actl6b (83766)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_031404.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000116767 CCTGGCATAACTACATGTGTA pLKO.1 817 CDS 100% 4.950 3.960 N ACTL6B n/a
2 TRCN0000090285 GATCATACCTACAGCAAACAT pLKO.1 381 CDS 100% 5.625 3.938 N Actl6b n/a
3 TRCN0000090284 ACAGACTTAATCGGGAGCTTT pLKO.1 1156 CDS 100% 4.950 3.465 N Actl6b n/a
4 TRCN0000090287 AGCATCGGCATGTGTGACATT pLKO.1 1065 CDS 100% 4.950 3.465 N Actl6b n/a
5 TRCN0000090286 CTGGCATAACTACATGTGTAA pLKO.1 818 CDS 100% 4.950 3.465 N Actl6b n/a
6 TRCN0000090283 GCAGTACAACATTCCTGCCTT pLKO.1 497 CDS 100% 2.640 1.848 N Actl6b n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_031404.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03302 pDONR223 100% 92.3% 99.7% None (many diffs) n/a
2 ccsbBroad304_03302 pLX_304 0% 92.3% 99.7% V5 (many diffs) n/a
3 TRCN0000478329 ATCGTGTAATAAACAACTTGGTCA pLX_317 25.4% 92.3% 99.7% V5 (many diffs) n/a
Download CSV