Transcript: Mouse NM_031870.3

Mus musculus mutS homolog 4 (Msh4), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-06-03
Taxon:
Mus musculus (mouse)
Gene:
Msh4 (55993)
Length:
3333
CDS:
155..3031

Additional Resources:

NCBI RefSeq record:
NM_031870.3
NBCI Gene record:
Msh4 (55993)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_031870.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000240905 GCGGAAAGTCCACGTACTTAA pLKO_005 2271 CDS 100% 13.200 18.480 N Msh4 n/a
2 TRCN0000240908 TCGCCAACAATACCTACATTA pLKO_005 2208 CDS 100% 13.200 18.480 N Msh4 n/a
3 TRCN0000240906 TCAGAATGGTCACCTACTATG pLKO_005 3110 3UTR 100% 10.800 15.120 N Msh4 n/a
4 TRCN0000187896 GCACCCAAATCGCTAAAGATT pLKO.1 1103 CDS 100% 5.625 7.875 N Msh4 n/a
5 TRCN0000204059 GTCGCCAACAATACCTACATT pLKO.1 2207 CDS 100% 5.625 7.875 N Msh4 n/a
6 TRCN0000240907 GACCATAGGTTTGGGCTAATA pLKO_005 1583 CDS 100% 13.200 10.560 N Msh4 n/a
7 TRCN0000187825 GCAACTTAGTTGCTCAGCTTT pLKO.1 3057 3UTR 100% 4.950 3.960 N Msh4 n/a
8 TRCN0000240904 CCAAGAGTCTTTGCGAGAAAT pLKO_005 1963 CDS 100% 13.200 9.240 N Msh4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_031870.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06595 pDONR223 100% 81% 81.7% None (many diffs) n/a
2 ccsbBroad304_06595 pLX_304 0% 81% 81.7% V5 (many diffs) n/a
3 TRCN0000468998 GATCAATTTTACTAGCCCCCCCCA pLX_317 3.8% 81% 81.7% V5 (many diffs) n/a
Download CSV