Transcript: Mouse NM_031874.5

Mus musculus RAB3D, member RAS oncogene family (Rab3d), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-06-10
Taxon:
Mus musculus (mouse)
Gene:
Rab3d (19340)
Length:
3948
CDS:
297..956

Additional Resources:

NCBI RefSeq record:
NM_031874.5
NBCI Gene record:
Rab3d (19340)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_031874.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000089447 CCGACATGACAAGAGGATCAA pLKO.1 491 CDS 100% 4.950 6.930 N Rab3d n/a
2 TRCN0000332299 CCGACATGACAAGAGGATCAA pLKO_005 491 CDS 100% 4.950 6.930 N Rab3d n/a
3 TRCN0000089443 CGGTGCAAATTATGTTCTTAA pLKO.1 2412 3UTR 100% 13.200 10.560 N Rab3d n/a
4 TRCN0000089446 CTACCGACATGACAAGAGGAT pLKO.1 488 CDS 100% 2.640 2.112 N Rab3d n/a
5 TRCN0000380411 GACTGGGCTACGCAGATCAAA pLKO_005 639 CDS 100% 5.625 3.938 N Rab3d n/a
6 TRCN0000379733 GCTCGCCGATGATCTTGGTTT pLKO_005 752 CDS 100% 4.950 3.465 N Rab3d n/a
7 TRCN0000089444 CAAACTGCTCTTGATCGGGAA pLKO.1 365 CDS 100% 2.160 1.512 N Rab3d n/a
8 TRCN0000375705 GCATCGACTTCAAGGTCAAGA pLKO_005 463 CDS 100% 4.950 2.970 N Rab3d n/a
9 TRCN0000089445 CATCATCTGTGACAAGATGAA pLKO.1 839 CDS 100% 0.495 0.297 N Rab3d n/a
10 TRCN0000332375 CATCATCTGTGACAAGATGAA pLKO_005 839 CDS 100% 0.495 0.297 N Rab3d n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_031874.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07442 pDONR223 100% 87.2% 94% None (many diffs) n/a
2 ccsbBroad304_07442 pLX_304 0% 87.2% 94% V5 (many diffs) n/a
3 TRCN0000491803 TTATCCCGTGAAAGACGACAATTC pLX_317 47.5% 87.2% 94% V5 (many diffs) n/a
Download CSV