Transcript: Human NM_031895.6

Homo sapiens calcium voltage-gated channel auxiliary subunit gamma 8 (CACNG8), mRNA.

Source:
NCBI, updated 2019-08-09
Taxon:
Homo sapiens (human)
Gene:
CACNG8 (59283)
Length:
8850
CDS:
207..1484

Additional Resources:

NCBI RefSeq record:
NM_031895.6
NBCI Gene record:
CACNG8 (59283)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_031895.6, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000044269 CTGCGTGAAGATCAATCATTT pLKO.1 506 CDS 100% 13.200 18.480 N CACNG8 n/a
2 TRCN0000044270 CTACAAGTCCAAGAGGAACAT pLKO.1 659 CDS 100% 4.950 3.465 N CACNG8 n/a
3 TRCN0000044272 GAGCAACATCATCGGCGTGAT pLKO.1 719 CDS 100% 4.050 2.835 N CACNG8 n/a
4 TRCN0000437095 ATGACCATCGCCATCAGCACT pLKO_005 309 CDS 100% 2.640 1.848 N CACNG8 n/a
5 TRCN0000429426 TTTGCCTCCACGGACATCTCC pLKO_005 1101 CDS 100% 0.880 0.616 N CACNG8 n/a
6 TRCN0000044268 GCGGAGTATCTACTCCGAGTT pLKO.1 558 CDS 100% 0.405 0.284 N CACNG8 n/a
7 TRCN0000044271 CGGCTTCCTCACGCTGCACAA pLKO.1 1295 CDS 100% 0.000 0.000 N CACNG8 n/a
8 TRCN0000140719 GATCACTTGAGGTCAGGAGTT pLKO.1 5150 3UTR 100% 4.050 2.025 Y P3H4 n/a
9 TRCN0000165299 GATCACTTGAGGTCAGGAGTT pLKO.1 5150 3UTR 100% 4.050 2.025 Y ORAI2 n/a
10 TRCN0000352971 GATCACTTGAGGTCAGGAGTT pLKO_005 5150 3UTR 100% 4.050 2.025 Y P3H4 n/a
11 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 5112 3UTR 100% 13.200 6.600 Y LIAS n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_031895.6, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.