Transcript: Human NM_031907.2

Homo sapiens ubiquitin specific peptidase 26 (USP26), mRNA.

Source:
NCBI, updated 2019-09-29
Taxon:
Homo sapiens (human)
Gene:
USP26 (83844)
Length:
3642
CDS:
53..2794

Additional Resources:

NCBI RefSeq record:
NM_031907.2
NBCI Gene record:
USP26 (83844)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_031907.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000011117 GCTATAATCGAGAGAAACAAT pLKO.1 696 CDS 100% 5.625 7.875 N USP26 n/a
2 TRCN0000011119 CTACTTTCAATCCCATCGTTT pLKO.1 989 CDS 100% 4.950 6.930 N USP26 n/a
3 TRCN0000417979 GTTACACAAAGTGGGATAAAT pLKO_005 876 CDS 100% 15.000 12.000 N USP26 n/a
4 TRCN0000415884 CACTTACTTGCGGAGAGTTAT pLKO_005 549 CDS 100% 13.200 10.560 N USP26 n/a
5 TRCN0000417035 TCCGTTGGAGTGCACTCATTC pLKO_005 1562 CDS 100% 10.800 8.640 N USP26 n/a
6 TRCN0000011118 GAATCCAAGAAACAAAGACAT pLKO.1 2437 CDS 100% 4.950 3.465 N USP26 n/a
7 TRCN0000011121 GCAGATTGTTCGAGGTGTGTA pLKO.1 674 CDS 100% 4.950 3.465 N USP26 n/a
8 TRCN0000011120 CAACTGAAAGATAACATGGAA pLKO.1 1229 CDS 100% 3.000 2.100 N USP26 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_031907.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09116 pDONR223 100% 99.9% 99.8% None 576G>A;2101T>A n/a
2 ccsbBroad304_09116 pLX_304 0% 99.9% 99.8% V5 576G>A;2101T>A n/a
3 TRCN0000468212 CCGAATTCTATACCTCCTCCGAGT pLX_317 15.6% 99.9% 99.8% V5 576G>A;2101T>A n/a
Download CSV