Transcript: Mouse NM_031997.4

Mus musculus transmembrane protein 2 (Tmem2), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-06-11
Taxon:
Mus musculus (mouse)
Gene:
Tmem2 (83921)
Length:
6702
CDS:
542..4693

Additional Resources:

NCBI RefSeq record:
NM_031997.4
NBCI Gene record:
Tmem2 (83921)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_031997.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000379263 GTTAACCCGATGGAACCATTT pLKO_005 4778 3UTR 100% 10.800 15.120 N Tmem2 n/a
2 TRCN0000126996 CGGCGATAAGAACTCCATCTT pLKO.1 3370 CDS 100% 4.950 6.930 N Tmem2 n/a
3 TRCN0000295559 CGTGAAAGTATGCCAATATTT pLKO_005 1172 CDS 100% 15.000 12.000 N Tmem2 n/a
4 TRCN0000295501 TGGTGTTGAACAGCGAAATAT pLKO_005 2368 CDS 100% 15.000 12.000 N Tmem2 n/a
5 TRCN0000295502 ATAGATCCAAAGCGACAATTA pLKO_005 1128 CDS 100% 13.200 10.560 N Tmem2 n/a
6 TRCN0000126995 CGCTTCATATTGGAGCAGAAA pLKO.1 1098 CDS 100% 4.950 3.960 N Tmem2 n/a
7 TRCN0000288272 CGCTTCATATTGGAGCAGAAA pLKO_005 1098 CDS 100% 4.950 3.960 N Tmem2 n/a
8 TRCN0000126998 CCATCCATTATTTCCGTCAAT pLKO.1 4223 CDS 100% 4.950 3.465 N Tmem2 n/a
9 TRCN0000126994 CCTTTCAAAGAGGGAACCTTA pLKO.1 5258 3UTR 100% 4.950 3.465 N Tmem2 n/a
10 TRCN0000126997 GCTGAATATCTCGGATTCATT pLKO.1 4432 CDS 100% 0.563 0.394 N Tmem2 n/a
11 TRCN0000331992 GCTGAATATCTCGGATTCATT pLKO_005 4432 CDS 100% 0.563 0.394 N Tmem2 n/a
12 TRCN0000295560 GGACTGGCTGCTCTAGCATTT pLKO_005 5027 3UTR 100% 10.800 6.480 N Tmem2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_031997.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07925 pDONR223 100% 84.5% 86.6% None (many diffs) n/a
2 ccsbBroad304_07925 pLX_304 0% 84.5% 86.6% V5 (many diffs) n/a
3 TRCN0000479297 TAGCCATTATAACCGGATCCTCGG pLX_317 10.1% 84.5% 86.6% V5 (many diffs) n/a
Download CSV