Transcript: Human NM_032015.5

Homo sapiens ring finger protein 26 (RNF26), mRNA.

Source:
NCBI, updated 2019-06-30
Taxon:
Homo sapiens (human)
Gene:
RNF26 (79102)
Length:
2783
CDS:
597..1898

Additional Resources:

NCBI RefSeq record:
NM_032015.5
NBCI Gene record:
RNF26 (79102)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_032015.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000439874 CTTTGGACACCCTGCCAACTA pLKO_005 1200 CDS 100% 4.950 6.930 N RNF26 n/a
2 TRCN0000438234 CAAGGGCCCTGAGACTATTTG pLKO_005 2135 3UTR 100% 13.200 9.240 N RNF26 n/a
3 TRCN0000033924 CCTTGTGTACTCTGCTGTATA pLKO.1 841 CDS 100% 13.200 9.240 N RNF26 n/a
4 TRCN0000427702 GGGCCTTCGGATGATCTTAAA pLKO_005 2333 3UTR 100% 13.200 9.240 N RNF26 n/a
5 TRCN0000033928 CCTGGTGGCTTATGTGATCAA pLKO.1 1022 CDS 100% 4.950 3.465 N RNF26 n/a
6 TRCN0000033925 GCCAGCTTTGTGCTTGTCAAT pLKO.1 1257 CDS 100% 4.950 3.465 N RNF26 n/a
7 TRCN0000033926 CCCTTGGAAATTGCTGAAGGA pLKO.1 1694 CDS 100% 2.640 1.848 N RNF26 n/a
8 TRCN0000033927 CTTGCTTTCATTGCTGGCCTT pLKO.1 779 CDS 100% 2.160 1.512 N RNF26 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_032015.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08921 pDONR223 100% 99.9% 100% None 543G>A n/a
2 ccsbBroad304_08921 pLX_304 0% 99.9% 100% V5 543G>A n/a
3 TRCN0000491453 CGCCTTTATCGAGCTGTTGGCGCA pLX_317 24.5% 99.9% 100% V5 543G>A n/a
Download CSV