Transcript: Human NM_032107.5

Homo sapiens L3MBTL histone methyl-lysine binding protein 1 (L3MBTL1), transcript variant II, mRNA.

Source:
NCBI, updated 2019-09-30
Taxon:
Homo sapiens (human)
Gene:
L3MBTL1 (26013)
Length:
3349
CDS:
60..2582

Additional Resources:

NCBI RefSeq record:
NM_032107.5
NBCI Gene record:
L3MBTL1 (26013)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_032107.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000329975 CTTTGCCAGTGATAGTCAATA pLKO_005 2558 CDS 100% 13.200 18.480 N L3MBTL1 n/a
2 TRCN0000016863 CCTCCGAAGTATCGAAAGATT pLKO.1 2127 CDS 100% 5.625 7.875 N L3MBTL1 n/a
3 TRCN0000329974 TACCAGAACGTCTAGTATAAT pLKO_005 2892 3UTR 100% 0.000 0.000 N L3MBTL1 n/a
4 TRCN0000353634 ATCGGATAAAGATCCACTTTG pLKO_005 1693 CDS 100% 10.800 7.560 N L3MBTL1 n/a
5 TRCN0000016864 GCCTGCACTTTGATGGGTATT pLKO.1 1069 CDS 100% 10.800 7.560 N L3MBTL1 n/a
6 TRCN0000329973 GCCTGCACTTTGATGGGTATT pLKO_005 1069 CDS 100% 10.800 7.560 N L3MBTL1 n/a
7 TRCN0000016867 GCAGTCACTCACAACAAGAAT pLKO.1 951 CDS 100% 5.625 3.938 N L3MBTL1 n/a
8 TRCN0000329972 GCAGTCACTCACAACAAGAAT pLKO_005 951 CDS 100% 5.625 3.938 N L3MBTL1 n/a
9 TRCN0000016866 GCTGGAGTCATGGCTATGATT pLKO.1 1717 CDS 100% 5.625 3.938 N L3MBTL1 n/a
10 TRCN0000016865 CCCACTCATTTGCTTGCCAAA pLKO.1 2532 CDS 100% 4.050 2.835 N L3MBTL1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_032107.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07978 pDONR223 100% 90.8% 88.1% None (many diffs) n/a
2 ccsbBroad304_07978 pLX_304 0% 90.8% 88.1% V5 (many diffs) n/a
3 TRCN0000478518 AGCGCGATGTGTAACCGAGCGTCA pLX_317 12.9% 90.8% 88.1% V5 (many diffs) n/a
Download CSV