Transcript: Human NM_032116.5

Homo sapiens katanin catalytic subunit A1 like 1 (KATNAL1), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-27
Taxon:
Homo sapiens (human)
Gene:
KATNAL1 (84056)
Length:
7618
CDS:
236..1708

Additional Resources:

NCBI RefSeq record:
NM_032116.5
NBCI Gene record:
KATNAL1 (84056)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_032116.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000365700 ACCTTCGTGAGGTCGAATTAG pLKO_005 1413 CDS 100% 13.200 18.480 N KATNAL1 n/a
2 TRCN0000370981 ATAATTGATGGCGAGAGTTTG pLKO_005 1870 3UTR 100% 10.800 15.120 N KATNAL1 n/a
3 TRCN0000116746 CCGAGAAGATTGAGGGCTATT pLKO.1 1461 CDS 100% 10.800 15.120 N KATNAL1 n/a
4 TRCN0000116743 GCCTTCTACAAGTAGGGACAA pLKO.1 676 CDS 100% 4.050 5.670 N KATNAL1 n/a
5 TRCN0000370982 TCCACGTATTCCTGCATTAAT pLKO_005 1922 3UTR 100% 15.000 12.000 N KATNAL1 n/a
6 TRCN0000365698 TAGGCCGAGCACATCCTATAT pLKO_005 642 CDS 100% 13.200 10.560 N KATNAL1 n/a
7 TRCN0000365782 GGTATTGGCTGCTACTAATTT pLKO_005 1294 CDS 100% 15.000 10.500 N KATNAL1 n/a
8 TRCN0000370983 GAGGAATATGAACAAGTTAAA pLKO_005 416 CDS 100% 13.200 9.240 N KATNAL1 n/a
9 TRCN0000116745 CCAGGAATCCTAGCATTCATT pLKO.1 834 CDS 100% 5.625 3.938 N KATNAL1 n/a
10 TRCN0000116744 CCTGTTACCAAAGGAGACTTT pLKO.1 1598 CDS 100% 4.950 3.465 N KATNAL1 n/a
11 TRCN0000116742 GCTCCTTTAATTCCTCTGAAA pLKO.1 4762 3UTR 100% 4.950 3.465 N KATNAL1 n/a
12 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 4205 3UTR 100% 5.625 2.813 Y KLHL30 n/a
13 TRCN0000166364 CACACACACACACACACACAA pLKO.1 4266 3UTR 100% 4.950 2.475 Y KAAG1 n/a
14 TRCN0000178741 CACACACATACACACACACAA pLKO.1 4395 3UTR 100% 4.950 2.475 Y Cstad n/a
15 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 4205 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_032116.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04317 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_04317 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000478756 GTTATTTAATCTTCACTGGGCATT pLX_317 23.1% 100% 100% V5 n/a
Download CSV