Transcript: Human NM_032151.5

Homo sapiens pterin-4 alpha-carbinolamine dehydratase 2 (PCBD2), mRNA.

Source:
NCBI, updated 2019-09-15
Taxon:
Homo sapiens (human)
Gene:
PCBD2 (84105)
Length:
2365
CDS:
10..402

Additional Resources:

NCBI RefSeq record:
NM_032151.5
NBCI Gene record:
PCBD2 (84105)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_032151.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000160308 CAAGCTATACTTGACCTTAAA pLKO.1 133 CDS 100% 13.200 18.480 N PCBD2 n/a
2 TRCN0000160391 CCAAGCTATACTTGACCTTAA pLKO.1 132 CDS 100% 10.800 15.120 N PCBD2 n/a
3 TRCN0000161707 GATGGTCGGAATTAAGTGAGA pLKO.1 161 CDS 100% 2.640 3.696 N PCBD2 n/a
4 TRCN0000160884 GAGAGGAACCAAGCTATACTT pLKO.1 124 CDS 100% 5.625 4.500 N PCBD2 n/a
5 TRCN0000161401 GATGAATCATCACCCAGAATG pLKO.1 267 CDS 100% 10.800 7.560 N PCBD2 n/a
6 TRCN0000158475 CAAGCAGAGAAGATGAATCAT pLKO.1 256 CDS 100% 5.625 3.938 N PCBD2 n/a
7 TRCN0000166701 CTTGACCTTAAAGCAGCAGGA pLKO.1 142 CDS 100% 2.160 1.512 N PCBD2 n/a
8 TRCN0000160885 GAGAAGATGAATCATCACCCA pLKO.1 262 CDS 100% 0.660 0.462 N PCBD2 n/a
9 TRCN0000164935 GCATTTGGCTTTATGTCCCGA pLKO.1 226 CDS 100% 0.660 0.462 N PCBD2 n/a
10 TRCN0000165041 GCAGGATGGTCGGAATTAAGT pLKO.1 157 CDS 100% 5.625 3.375 N PCBD2 n/a
11 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 743 3UTR 100% 5.625 2.813 Y KLHL30 n/a
12 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 743 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_032151.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04330 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_04330 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000465308 GAGCCAATAGGTTGGGCTGGTAGC pLX_317 87% 100% 100% V5 n/a
Download CSV