Transcript: Human NM_032228.6

Homo sapiens fatty acyl-CoA reductase 1 (FAR1), mRNA.

Source:
NCBI, updated 2019-08-22
Taxon:
Homo sapiens (human)
Gene:
FAR1 (84188)
Length:
5266
CDS:
147..1694

Additional Resources:

NCBI RefSeq record:
NM_032228.6
NBCI Gene record:
FAR1 (84188)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_032228.6, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000375546 ATATTGATGTACGGCAGTTAC pLKO_005 1411 CDS 100% 10.800 15.120 N Far1 n/a
2 TRCN0000150104 CTTTGTGGTTAGTCTGTGTTA pLKO.1 1628 CDS 100% 4.950 6.930 N FAR1 n/a
3 TRCN0000366666 ATGGATGATGGCCTAGTAAAT pLKO_005 696 CDS 100% 13.200 10.560 N Far1 n/a
4 TRCN0000179274 GCAGTGTATCTGGAGTATGTT pLKO.1 3077 3UTR 100% 5.625 4.500 N FAR1 n/a
5 TRCN0000183345 GCTGTTCAGTTAAATGTGATT pLKO.1 516 CDS 100% 4.950 3.960 N FAR1 n/a
6 TRCN0000146593 CCAGGATGGATTGATAACTTT pLKO.1 867 CDS 100% 5.625 3.938 N FAR1 n/a
7 TRCN0000183238 GCAAGAAATATCTGGTACTTT pLKO.1 1611 CDS 100% 5.625 3.938 N FAR1 n/a
8 TRCN0000150038 CCAAGAAACATCATGGTGTAT pLKO.1 1035 CDS 100% 4.950 3.465 N FAR1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_032228.6, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14307 pDONR223 100% 99.9% .7% None 5delT n/a
2 ccsbBroad304_14307 pLX_304 0% 99.9% .7% V5 (not translated due to prior stop codon) 5delT n/a
3 TRCN0000474278 GGGCAAAGCCCTTCATGATTTGAT pLX_317 33.3% 99.9% .7% V5 (not translated due to prior stop codon) 5delT n/a
Download CSV