Transcript: Human NM_032287.3

Homo sapiens retrotransposon Gag like 6 (RTL6), mRNA.

Source:
NCBI, updated 2019-05-02
Taxon:
Homo sapiens (human)
Gene:
RTL6 (84247)
Length:
5419
CDS:
446..1165

Additional Resources:

NCBI RefSeq record:
NM_032287.3
NBCI Gene record:
RTL6 (84247)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_032287.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000419697 CCAGGTAGCATACGCTCTTTG pLKO_005 1200 3UTR 100% 10.800 15.120 N RTL6 n/a
2 TRCN0000425223 GACTACCGCTCTGCTACTTAG pLKO_005 1434 3UTR 100% 10.800 15.120 N RTL6 n/a
3 TRCN0000118092 CCGCCATATTTCAATGCCAAA pLKO.1 2543 3UTR 100% 4.050 5.670 N RTL6 n/a
4 TRCN0000424249 TGCCCGAGCACGGAATCTTTA pLKO_005 1144 CDS 100% 13.200 10.560 N RTL6 n/a
5 TRCN0000428592 CCTGGTTGCCCAGTTCCTATT pLKO_005 1568 3UTR 100% 10.800 8.640 N RTL6 n/a
6 TRCN0000424648 AGAGTTGCGGAGAACCTACAA pLKO_005 958 CDS 100% 4.950 3.960 N RTL6 n/a
7 TRCN0000118095 AGGAAGACTTCTGCCTCTAAT pLKO.1 1013 CDS 100% 13.200 9.240 N RTL6 n/a
8 TRCN0000118093 GCCCAGATGGATGACGTTATT pLKO.1 503 CDS 100% 13.200 9.240 N RTL6 n/a
9 TRCN0000118094 CCATCTCCTCAATTACTTCAA pLKO.1 690 CDS 100% 4.950 3.465 N RTL6 n/a
10 TRCN0000118096 GATGGACAGATTCATGATCTT pLKO.1 799 CDS 100% 4.950 3.465 N RTL6 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_032287.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.