Transcript: Human NM_032313.4

Homo sapiens nitric oxide associated 1 (NOA1), mRNA.

Source:
NCBI, updated 2019-05-02
Taxon:
Homo sapiens (human)
Gene:
NOA1 (84273)
Length:
2218
CDS:
22..2118

Additional Resources:

NCBI RefSeq record:
NM_032313.4
NBCI Gene record:
NOA1 (84273)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_032313.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000147467 CAAGTAGAATTGACTGCACAA pLKO.1 1459 CDS 100% 4.050 3.240 N NOA1 n/a
2 TRCN0000129917 GAAATCAGTCAGCTTGGTTTA pLKO.1 1670 CDS 100% 10.800 7.560 N NOA1 n/a
3 TRCN0000150281 CCAACTCCTTACAGAATGTTT pLKO.1 1204 CDS 100% 5.625 3.938 N NOA1 n/a
4 TRCN0000292155 CCAACTCCTTACAGAATGTTT pLKO_005 1204 CDS 100% 5.625 3.938 N NOA1 n/a
5 TRCN0000128420 GAGTTTGATGCTGATTCACTT pLKO.1 1387 CDS 100% 4.950 3.465 N NOA1 n/a
6 TRCN0000146669 CAGAAGGATAACATTCCCTTT pLKO.1 1366 CDS 100% 4.050 2.835 N NOA1 n/a
7 TRCN0000281396 CAGAAGGATAACATTCCCTTT pLKO_005 1366 CDS 100% 4.050 2.835 N NOA1 n/a
8 TRCN0000149579 GCCAGGTACTACATTAAACCT pLKO.1 1161 CDS 100% 3.000 2.100 N NOA1 n/a
9 TRCN0000292156 GCCAGGTACTACATTAAACCT pLKO_005 1161 CDS 100% 3.000 2.100 N NOA1 n/a
10 TRCN0000149824 CCTTATGTACAACGTGAGGAA pLKO.1 2073 CDS 100% 2.640 1.848 N NOA1 n/a
11 TRCN0000150134 GATCTTAGTGAGCAAGAACAA pLKO.1 1270 CDS 100% 4.950 2.970 N NOA1 n/a
12 TRCN0000281319 GATCTTAGTGAGCAAGAACAA pLKO_005 1270 CDS 100% 4.950 2.970 N NOA1 n/a
13 TRCN0000129369 GAAGAGTTGATCTCTGCCCTT pLKO.1 994 CDS 100% 2.160 1.296 N NOA1 n/a
14 TRCN0000292157 GAAGAGTTGATCTCTGCCCTT pLKO_005 994 CDS 100% 2.160 1.296 N NOA1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_032313.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04353 pDONR223 100% 99.9% 100% None 432T>C n/a
2 ccsbBroad304_04353 pLX_304 0% 99.9% 100% V5 432T>C n/a
3 TRCN0000478832 AGTAGGTTCAACCGCAAACAGATC pLX_317 18.8% 99.9% 100% V5 432T>C n/a
Download CSV