Transcript: Human NM_032315.3

Homo sapiens solute carrier family 25 member 33 (SLC25A33), mRNA.

Source:
NCBI, updated 2019-08-07
Taxon:
Homo sapiens (human)
Gene:
SLC25A33 (84275)
Length:
3865
CDS:
228..1193

Additional Resources:

NCBI RefSeq record:
NM_032315.3
NBCI Gene record:
SLC25A33 (84275)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_032315.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000060050 GCTGGAATTTCCGAAACTATA pLKO.1 810 CDS 100% 13.200 18.480 N SLC25A33 n/a
2 TRCN0000423195 CAGTGTGCTCGTTACGTTTAC pLKO_005 741 CDS 100% 10.800 15.120 N SLC25A33 n/a
3 TRCN0000060051 GCTTATCCACACGAAGTCATA pLKO.1 978 CDS 100% 4.950 6.930 N SLC25A33 n/a
4 TRCN0000431216 TATCTGGTTCATATCACCTGT pLKO_005 1303 3UTR 100% 2.640 2.112 N SLC25A33 n/a
5 TRCN0000432516 ATTGTGCTCTAGAAGAATAAA pLKO_005 1205 3UTR 100% 15.000 10.500 N SLC25A33 n/a
6 TRCN0000060049 GCCATTGTGTTGTCTACTTAT pLKO.1 1134 CDS 100% 13.200 9.240 N SLC25A33 n/a
7 TRCN0000431211 TGGCTTCTATAGAGGATTAAC pLKO_005 779 CDS 100% 13.200 9.240 N SLC25A33 n/a
8 TRCN0000060048 CCCATTGATGTTTAGAAAGTT pLKO.1 1254 3UTR 100% 5.625 3.938 N SLC25A33 n/a
9 TRCN0000060052 CCCAAATACTGCCATTGTGTT pLKO.1 1124 CDS 100% 4.950 3.465 N SLC25A33 n/a
10 TRCN0000413995 CAAAGCCAAAGAGCAATTTAA pLKO_005 566 CDS 100% 15.000 9.000 N SLC25A33 n/a
11 TRCN0000164801 CCTCCCAAAGTACTGGGATTA pLKO.1 3345 3UTR 100% 1.080 0.540 Y MAPKAPK5-AS1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_032315.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09172 pDONR223 100% 99.8% 99.6% None 320T>C n/a
2 ccsbBroad304_09172 pLX_304 0% 99.8% 99.6% V5 320T>C n/a
3 TRCN0000467020 TTCATTTTCCATGGAAACCTATGT pLX_317 36.9% 99.8% 99.6% V5 320T>C n/a
Download CSV