Transcript: Human NM_032328.3

Homo sapiens EF-hand calcium binding domain 2 (EFCAB2), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-02-21
Taxon:
Homo sapiens (human)
Gene:
EFCAB2 (84288)
Length:
1240
CDS:
266..754

Additional Resources:

NCBI RefSeq record:
NM_032328.3
NBCI Gene record:
EFCAB2 (84288)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_032328.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000056438 GAGTCGAATAATACAGTGGAT pLKO.1 350 CDS 100% 2.640 3.696 N EFCAB2 n/a
2 TRCN0000056442 CTGCAATTGATCCAGAATCAA pLKO.1 681 CDS 100% 0.563 0.788 N EFCAB2 n/a
3 TRCN0000056439 GATTCAGCTAAACGTGGGTTT pLKO.1 578 CDS 100% 4.050 3.240 N EFCAB2 n/a
4 TRCN0000413773 ATACCTTGTGACATAACTATT pLKO_005 854 3UTR 100% 13.200 9.240 N EFCAB2 n/a
5 TRCN0000056440 CTTCCGGTGATGACAGAAATA pLKO.1 494 CDS 100% 13.200 9.240 N EFCAB2 n/a
6 TRCN0000216317 GAAATGTTGTCTGCTGCAATT pLKO.1 668 CDS 100% 10.800 7.560 N Efcab2 n/a
7 TRCN0000427924 TTGGCATGTAAAGATCTTAAG pLKO_005 1087 3UTR 100% 10.800 7.560 N EFCAB2 n/a
8 TRCN0000056441 TGGAACAATTATCAGGTCATT pLKO.1 382 CDS 100% 4.950 3.465 N EFCAB2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_032328.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09177 pDONR223 100% 99.7% 100% None 201C>T n/a
2 ccsbBroad304_09177 pLX_304 0% 99.7% 100% V5 201C>T n/a
3 TRCN0000475986 GGCTTAACTGACACAGGATACTTT pLX_317 57.9% 99.7% 100% V5 201C>T n/a
Download CSV