Transcript: Human NM_032335.3

Homo sapiens PHD finger protein 6 (PHF6), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-09-16
Taxon:
Homo sapiens (human)
Gene:
PHF6 (84295)
Length:
1236
CDS:
203..1141

Additional Resources:

NCBI RefSeq record:
NM_032335.3
NBCI Gene record:
PHF6 (84295)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_032335.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000367877 TAGTGACACCAGGCCTAAATG pLKO_005 820 CDS 100% 13.200 18.480 N PHF6 n/a
2 TRCN0000020123 CATCACACTCTGATAATGAAA pLKO.1 363 CDS 100% 5.625 7.875 N PHF6 n/a
3 TRCN0000020120 CCATTATAAGTGCATGTTGTT pLKO.1 919 CDS 100% 4.950 6.930 N PHF6 n/a
4 TRCN0000020121 CCACTGTGCATTGCATGATAA pLKO.1 517 CDS 100% 13.200 10.560 N PHF6 n/a
5 TRCN0000415035 CCACTGTGCATTGCATGATAA pLKO_005 517 CDS 100% 13.200 10.560 N Phf6 n/a
6 TRCN0000369376 AGGAATTTACATGGTCTATTG pLKO_005 565 CDS 100% 10.800 8.640 N PHF6 n/a
7 TRCN0000020119 GCACCATAAGTGCATGCTCTT pLKO.1 325 CDS 100% 4.050 3.240 N PHF6 n/a
8 TRCN0000369303 ACTGTACTTCAGGAGATTAAA pLKO_005 1004 CDS 100% 15.000 10.500 N PHF6 n/a
9 TRCN0000367878 AGAAGGCAGCTGCCCATTATA pLKO_005 906 CDS 100% 15.000 10.500 N PHF6 n/a
10 TRCN0000369374 ACTCCGAAGCAGCTGATTTAG pLKO_005 612 CDS 100% 13.200 9.240 N PHF6 n/a
11 TRCN0000367915 GGCCTACAAGACAGCGCAAAT pLKO_005 231 CDS 100% 10.800 7.560 N PHF6 n/a
12 TRCN0000020122 CAGAATTTGGAGACTTTGATA pLKO.1 978 CDS 100% 5.625 3.375 N PHF6 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_032335.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09179 pDONR223 100% 99.7% 99.3% None 13G>A;377T>C n/a
2 ccsbBroad304_09179 pLX_304 0% 99.7% 99.3% V5 13G>A;377T>C n/a
3 TRCN0000466260 ACAACACCCACTGATGGAATCTCC pLX_317 41.6% 99.7% 99.3% V5 13G>A;377T>C n/a
Download CSV