Transcript: Human NM_032353.4

Homo sapiens vacuolar protein sorting 25 homolog (VPS25), mRNA.

Source:
NCBI, updated 2019-09-27
Taxon:
Homo sapiens (human)
Gene:
VPS25 (84313)
Length:
1088
CDS:
28..558

Additional Resources:

NCBI RefSeq record:
NM_032353.4
NBCI Gene record:
VPS25 (84313)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_032353.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000142608 GTGGAGTCGATCCAGATTGTA pLKO.1 238 CDS 100% 5.625 7.875 N VPS25 n/a
2 TRCN0000144276 CTTCTTTACGTTACAACCGAA pLKO.1 72 CDS 100% 2.640 3.696 N VPS25 n/a
3 TRCN0000122421 GAGATCATCACTGTCAGCGAT pLKO.1 514 CDS 100% 2.640 2.112 N VPS25 n/a
4 TRCN0000322707 AGTCGATCCAGATTGTATTAG pLKO_005 242 CDS 100% 13.200 9.240 N VPS25 n/a
5 TRCN0000322706 ATCGCTTCCCACCCTTCTTTA pLKO_005 59 CDS 100% 13.200 9.240 N VPS25 n/a
6 TRCN0000144757 GAGTCGATCCAGATTGTATTA pLKO.1 241 CDS 100% 13.200 9.240 N VPS25 n/a
7 TRCN0000350694 GCCAGAACAACTCCGTCTTTA pLKO_005 383 CDS 100% 13.200 9.240 N VPS25 n/a
8 TRCN0000380013 AGCACAAGGCCGAGATCATCA pLKO_005 503 CDS 100% 4.950 3.465 N VPS25 n/a
9 TRCN0000381980 AGTCCAGCTTCCTGATCATGT pLKO_005 308 CDS 100% 4.950 3.465 N VPS25 n/a
10 TRCN0000142365 GCTCTTCAACAACGTCAAGCT pLKO.1 201 CDS 100% 2.640 1.848 N VPS25 n/a
11 TRCN0000141204 CCCTTTACTTCTTACCTCCCA pLKO.1 572 3UTR 100% 0.660 0.462 N VPS25 n/a
12 TRCN0000322763 CCCTTTACTTCTTACCTCCCA pLKO_005 572 3UTR 100% 0.660 0.462 N VPS25 n/a
13 TRCN0000143104 CATATGTCTGTCCCTTGGATA pLKO.1 717 3UTR 100% 0.000 0.000 N VPS25 n/a
14 TRCN0000322764 CATATGTCTGTCCCTTGGATA pLKO_005 717 3UTR 100% 0.000 0.000 N VPS25 n/a
15 TRCN0000143764 CCTGTCTCCCTTTACTTCTTA pLKO.1 565 3UTR 100% 5.625 3.375 N VPS25 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_032353.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04373 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_04373 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000471308 CCTAGACTTCTCAAATCAGGACAC pLX_317 80.8% 100% 100% V5 n/a
Download CSV