Transcript: Human NM_032679.2

Homo sapiens zinc finger protein 577 (ZNF577), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-06-04
Taxon:
Homo sapiens (human)
Gene:
ZNF577 (84765)
Length:
3096
CDS:
392..1849

Additional Resources:

NCBI RefSeq record:
NM_032679.2
NBCI Gene record:
ZNF577 (84765)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_032679.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000435810 ATAAGAGAGACAGCCATAAAT pLKO_005 1520 CDS 100% 15.000 10.500 N ZNF577 n/a
2 TRCN0000436673 TGATGGCAACTCACCAAATTA pLKO_005 2241 3UTR 100% 15.000 10.500 N ZNF577 n/a
3 TRCN0000016697 CAGAGAATAAGCCTCACAAAT pLKO.1 1763 CDS 100% 13.200 9.240 N ZNF577 n/a
4 TRCN0000016695 CCCACATGTCAGTCCTCATTA pLKO.1 1482 CDS 100% 13.200 9.240 N ZNF577 n/a
5 TRCN0000016696 CAAGCCAGATTCGCTCTTCAA pLKO.1 592 CDS 100% 4.950 3.465 N ZNF577 n/a
6 TRCN0000016693 CCTTTGTAGTTAATCAGGAAT pLKO.1 1737 CDS 100% 4.950 3.465 N ZNF577 n/a
7 TRCN0000240204 ATACGGGAGAGAAACCTTATG pLKO_005 1350 CDS 100% 10.800 5.400 Y EG665449 n/a
8 TRCN0000284648 ATACAGGAGAGAAACCCTATA pLKO_005 1098 CDS 100% 10.800 5.400 Y Gm14308 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_032679.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12854 pDONR223 100% 98.2% 97.9% None (many diffs) n/a
2 ccsbBroad304_12854 pLX_304 0% 98.2% 97.9% V5 (many diffs) n/a
3 TRCN0000470731 ACAATCTGAACATGTGTTTCTGTC pLX_317 33.8% 98.2% 97.9% V5 (many diffs) n/a
Download CSV