Transcript: Human NM_032758.4

Homo sapiens PHD finger protein 5A (PHF5A), mRNA.

Source:
NCBI, updated 2019-09-27
Taxon:
Homo sapiens (human)
Gene:
PHF5A (84844)
Length:
1053
CDS:
40..372

Additional Resources:

NCBI RefSeq record:
NM_032758.4
NBCI Gene record:
PHF5A (84844)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_032758.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000293614 GGGTCTCTGATGCCTATTATT pLKO_005 233 CDS 100% 15.000 21.000 N PHF5A n/a
2 TRCN0000074881 GACCTCTTCTATGAACGCAAA pLKO.1 328 CDS 100% 4.050 5.670 N PHF5A n/a
3 TRCN0000293548 GGCTTCAAGAAGAGGTGATTG pLKO_005 355 CDS 100% 10.800 7.560 N PHF5A n/a
4 TRCN0000074879 CCATCGGAAGACTGTGTGAAA pLKO.1 92 CDS 100% 4.950 3.465 N PHF5A n/a
5 TRCN0000286156 CCATCGGAAGACTGTGTGAAA pLKO_005 92 CDS 100% 4.950 3.465 N PHF5A n/a
6 TRCN0000074878 GCCTACTACTACCAGCAGAAA pLKO.1 431 3UTR 100% 4.950 3.465 N PHF5A n/a
7 TRCN0000286158 GCCTACTACTACCAGCAGAAA pLKO_005 431 3UTR 100% 4.950 3.465 N PHF5A n/a
8 TRCN0000074882 TGTGTGATTTGTGACTCCTAT pLKO.1 127 CDS 100% 4.950 3.465 N PHF5A n/a
9 TRCN0000286157 TGTGTGATTTGTGACTCCTAT pLKO_005 127 CDS 100% 4.950 3.465 N PHF5A n/a
10 TRCN0000074880 GCGCATATGTGATGAGTGTAA pLKO.1 168 CDS 100% 0.000 0.000 N PHF5A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_032758.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04431 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_04431 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000466910 CCCCCAAGAAGTAACGAAGAGGGA pLX_317 92.5% 100% 100% V5 n/a
Download CSV