Transcript: Human NM_032775.4

Homo sapiens kelch like family member 22 (KLHL22), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-05-02
Taxon:
Homo sapiens (human)
Gene:
KLHL22 (84861)
Length:
2528
CDS:
70..1974

Additional Resources:

NCBI RefSeq record:
NM_032775.4
NBCI Gene record:
KLHL22 (84861)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_032775.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000241849 CGACCAGGCCAAGTATCTAAA pLKO_005 1014 CDS 100% 13.200 18.480 N KLHL22 n/a
2 TRCN0000241848 GGGCCCTTCTCTACCATTATA pLKO_005 716 CDS 100% 15.000 10.500 N KLHL22 n/a
3 TRCN0000241847 TGAGCAACTGGACACCTATAT pLKO_005 573 CDS 100% 13.200 9.240 N KLHL22 n/a
4 TRCN0000241845 ACTACCACAATGACCTGAATG pLKO_005 1292 CDS 100% 10.800 7.560 N KLHL22 n/a
5 TRCN0000241846 AGATCCCAGGCTGTGGATTAC pLKO_005 2163 3UTR 100% 10.800 7.560 N KLHL22 n/a
6 TRCN0000158476 CTACAATGCTATGTGCCAAAT pLKO.1 360 CDS 100% 10.800 7.560 N KLHL22 n/a
7 TRCN0000162365 CCTCAACAAGCTGTATGTGAT pLKO.1 1542 CDS 100% 4.950 3.465 N KLHL22 n/a
8 TRCN0000164475 CGGTGCTCAACAACTTCGTAT pLKO.1 1103 CDS 100% 4.950 3.465 N KLHL22 n/a
9 TRCN0000158741 GATCCCAGAAATTATCCATTT pLKO.1 462 CDS 100% 10.800 6.480 N KLHL22 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_032775.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04434 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_04434 pLX_304 0% 100% 100% V5 n/a
Download CSV