Transcript: Human NM_032783.5

Homo sapiens carbonyl reductase 4 (CBR4), mRNA.

Source:
NCBI, updated 2019-05-02
Taxon:
Homo sapiens (human)
Gene:
CBR4 (84869)
Length:
3440
CDS:
167..880

Additional Resources:

NCBI RefSeq record:
NM_032783.5
NBCI Gene record:
CBR4 (84869)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_032783.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000234666 GGTAAATGCAGCTGGTATTAA pLKO_005 406 CDS 100% 15.000 21.000 N CBR4 n/a
2 TRCN0000046398 GCGGAGATCATTTGGCATTTA pLKO.1 306 CDS 100% 13.200 18.480 N CBR4 n/a
3 TRCN0000046399 CCGTATATTACAGGGCATGTT pLKO.1 824 CDS 100% 4.950 6.930 N CBR4 n/a
4 TRCN0000234668 CCCACTAAAGATAACTATATT pLKO_005 1470 3UTR 100% 15.000 10.500 N CBR4 n/a
5 TRCN0000234664 CAGAGCTGTGGCCCAGTTAAT pLKO_005 211 CDS 100% 13.200 9.240 N CBR4 n/a
6 TRCN0000234665 TGACCTCGGCGGAGATCATTT pLKO_005 298 CDS 100% 13.200 9.240 N CBR4 n/a
7 TRCN0000234667 CAACTCTGGCCAGTCCGTTTA pLKO_005 589 CDS 100% 10.800 7.560 N CBR4 n/a
8 TRCN0000046402 GCCAGTAAAGGAGGATTAGTT pLKO.1 614 CDS 100% 5.625 3.938 N CBR4 n/a
9 TRCN0000046401 GCTGCCATGAGGACTATGATT pLKO.1 515 CDS 100% 5.625 3.938 N CBR4 n/a
10 TRCN0000046400 CCAGGATTTGTACACACAGAT pLKO.1 698 CDS 100% 4.950 3.465 N CBR4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_032783.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04435 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_04435 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000474263 TACTCCCTCTCAGTCCGGCTGGTA pLX_317 79.7% 100% 100% V5 n/a
4 ccsbBroadEn_09231 pDONR223 100% 99.8% 99.5% None 208C>A n/a
5 ccsbBroad304_09231 pLX_304 0% 99.8% 99.5% V5 208C>A n/a
6 TRCN0000470562 TTGTAGATAGGATCATCGACATTA pLX_317 51.8% 99.8% 99.5% V5 208C>A n/a
Download CSV