Construct: ORF TRCN0000470562
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF017714.1_s317c1
- Derived from:
- ccsbBroadEn_09231
- DNA Barcode:
- TTGTAGATAGGATCATCGACATTA
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- CBR4 (84869)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000470562
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 84869 | CBR4 | carbonyl reductase 4 | NM_032783.5 | 99.8% | 99.5% | 208C>A |
| 2 | human | 84869 | CBR4 | carbonyl reductase 4 | XM_006714391.1 | 95.8% | 95.5% | 208C>A;401_430del |
| 3 | human | 84869 | CBR4 | carbonyl reductase 4 | XM_005263315.3 | 81.8% | 77.4% | (many diffs) |
| 4 | human | 84869 | CBR4 | carbonyl reductase 4 | XM_011532385.1 | 80.8% | 80.5% | 208C>A;398_399ins135 |
| 5 | human | 84869 | CBR4 | carbonyl reductase 4 | XM_005263316.4 | 80.5% | 72% | (many diffs) |
| 6 | human | 84869 | CBR4 | carbonyl reductase 4 | XM_017008782.1 | 78.5% | 74.2% | (many diffs) |
| 7 | human | 84869 | CBR4 | carbonyl reductase 4 | XM_006714392.3 | 77.3% | 69.2% | (many diffs) |
| 8 | human | 84869 | CBR4 | carbonyl reductase 4 | XM_017008783.2 | 74.6% | 72% | (many diffs) |
| 9 | human | 84869 | CBR4 | carbonyl reductase 4 | XR_001741341.1 | 56.9% | (many diffs) | |
| 10 | human | 84869 | CBR4 | carbonyl reductase 4 | XM_011532386.2 | 55.8% | 55.8% | 0_1ins297;104_133del |
| 11 | mouse | 234309 | Cbr4 | carbonyl reductase 4 | NM_145595.2 | 85% | 86.4% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 777
- ORF length:
- 711
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgga caaagtgtgt gctgtttttg gaggctcccg aggcattggc agagctgtgg 121 cccagttaat ggcccggaaa ggctaccgac tggcggtcat tgccagaaac ctggaagggg 181 ccaaagccgc cgccggtgac ctcggcggag atcatttggc atttagctgt gatgttgcta 241 aagaacatga tgttcaaaat acatttgaag agatggagaa acatttaggt cgagtaaatt 301 tcttggtaaa tgcagctggt attaacaggg atggtctttt agtaagaaca aaaactgaag 361 atatggtatc tcagcttcat actaacctct tgggttccat gctgacctGT AAAGCTGCCA 421 TGAGGACTAT GATTCAACAA CAGGGAGGGT CTATTGTTAA TGTAGGAAGC ATTGTTGGCT 481 TAAAAGGCAA CTCTGGCCAG TCCGTTTACA GTGCCAGTAA AGGAGGATTA GTTGGATTTT 541 CACGTGCTCT TGCTAAAGAG GTAGCAAGAA AGAAAATTAG AGTGAATGTA GTTGCACCAG 601 GATTTGTACA CACAGATATG ACGAAAGACT TGAAAGAAGA ACATTTAAAG AAAAATATTC 661 CTCTTGGGAG GTTTGGAGAA ACTATTGAGG TGGCACATGC GGTTGTGTTT CTTTTAGAAT 721 CACCGTATAT TACAGGGCAT GTTCTGGTAG TGGATGGGGG ATTACAACTC ATTTTGTACC 781 CAACTTTCTT GTACAAAGTG GTTGATATCG GTAAGCCTAT CCCTAACCCT CTCCTCGGTC 841 TCGATTCTAC GTAGTAATGA ACTAGTCCGT AACTTGAAAG TATTTCGATT TCTTGGCTTT 901 ATATATCTTG TGGAAAGGAC GATTGTAGAT AGGATCATCG ACATTAACGC GTTAAGTCga 961 caatcaacct ctggattaca aaatttgtga aagatt