Transcript: Human NM_032784.5

Homo sapiens R-spondin 3 (RSPO3), mRNA.

Source:
NCBI, updated 2019-07-10
Taxon:
Homo sapiens (human)
Gene:
RSPO3 (84870)
Length:
4815
CDS:
523..1341

Additional Resources:

NCBI RefSeq record:
NM_032784.5
NBCI Gene record:
RSPO3 (84870)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_032784.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000373390 TCATGTAAGCCCAGACTATTT pLKO_005 688 CDS 100% 13.200 18.480 N RSPO3 n/a
2 TRCN0000056666 CCAGCGAAGAATGCATCCTAA pLKO.1 609 CDS 100% 4.950 3.960 N RSPO3 n/a
3 TRCN0000373389 TCTTCATACAAGCATAGTTAA pLKO_005 1482 3UTR 100% 13.200 9.240 N RSPO3 n/a
4 TRCN0000373388 ACATTCCCAGTAGTTGCTATA pLKO_005 1460 3UTR 100% 10.800 7.560 N RSPO3 n/a
5 TRCN0000056665 CCCAACAAATGAGACAAGAAA pLKO.1 1095 CDS 100% 5.625 3.938 N RSPO3 n/a
6 TRCN0000056664 CCTTGGAAAGTGCCTTGACAA pLKO.1 885 CDS 100% 4.950 3.465 N RSPO3 n/a
7 TRCN0000056667 GCATCCTTCAGCAAAGGGTAA pLKO.1 1065 CDS 100% 4.050 2.835 N RSPO3 n/a
8 TRCN0000056663 GCTGTGCAACATGCTCAGATT pLKO.1 653 CDS 100% 4.950 2.970 N RSPO3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_032784.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04436 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_04436 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000475502 GTGAGATATTAACGAGACCCATCA pLX_317 48.2% 100% 100% V5 n/a
Download CSV