Transcript: Human NM_032797.6

Homo sapiens apoptosis inducing factor mitochondria associated 2 (AIFM2), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-08-06
Taxon:
Homo sapiens (human)
Gene:
AIFM2 (84883)
Length:
3134
CDS:
106..1227

Additional Resources:

NCBI RefSeq record:
NM_032797.6
NBCI Gene record:
AIFM2 (84883)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_032797.6, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000064427 CAATGAGTATCGAGAGTACAT pLKO.1 756 CDS 100% 4.950 6.930 N AIFM2 n/a
2 TRCN0000064424 CATTTCTTACTCGGTGACTTT pLKO.1 303 CDS 100% 4.950 6.930 N AIFM2 n/a
3 TRCN0000064423 CGGGCAAGTTTAATGAGGTTT pLKO.1 452 CDS 100% 4.950 3.960 N AIFM2 n/a
4 TRCN0000064425 CCTGCCCTTCTCTCATCTTAT pLKO.1 402 CDS 100% 13.200 9.240 N AIFM2 n/a
5 TRCN0000425664 ATGATGTGGTGGCTAGAAATG pLKO_005 1342 3UTR 100% 10.800 7.560 N AIFM2 n/a
6 TRCN0000064426 CAACATCGTCAACTCTGTGAA pLKO.1 1026 CDS 100% 4.950 3.465 N AIFM2 n/a
7 TRCN0000430881 GATTCTCTGCACCGGCATCAA pLKO_005 822 CDS 100% 4.950 3.465 N AIFM2 n/a
8 TRCN0000432192 GTACGTGCTTGTGGTCATGAC pLKO_005 1558 3UTR 100% 4.050 2.835 N AIFM2 n/a
9 TRCN0000430981 GCCACCATGCCTGGCTAATTT pLKO_005 2010 3UTR 100% 15.000 7.500 Y GTF2IRD2 n/a
10 TRCN0000264189 CAAGTAGCTGGGACTACAGGA pLKO_005 1985 3UTR 100% 2.640 1.320 Y LINC01098 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_032797.6, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09234 pDONR223 100% 99.9% 100% None 765G>A n/a
2 ccsbBroad304_09234 pLX_304 0% 99.9% 100% V5 765G>A n/a
3 TRCN0000481067 ACGTCCCCAGTAGGGAACCTACCT pLX_317 47.2% 99.9% 100% V5 765G>A n/a
Download CSV