Transcript: Human NM_032837.2

Homo sapiens family with sequence similarity 104 member A (FAM104A), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-05-04
Taxon:
Homo sapiens (human)
Gene:
FAM104A (84923)
Length:
2842
CDS:
89..649

Additional Resources:

NCBI RefSeq record:
NM_032837.2
NBCI Gene record:
FAM104A (84923)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_032837.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000144351 CGTACTGAAATGAAACGTGTA pLKO.1 2473 3UTR 100% 4.050 5.670 N FAM104A n/a
2 TRCN0000140299 GCTAACCTAATGTGGGCAGAA pLKO.1 2126 3UTR 100% 4.050 3.240 N FAM104A n/a
3 TRCN0000140995 CGGAAAGGATACACTGCTAAT pLKO.1 2322 3UTR 100% 10.800 7.560 N FAM104A n/a
4 TRCN0000140739 GTAGCAGAAACCCTGTCTTTC pLKO.1 369 CDS 100% 10.800 7.560 N FAM104A n/a
5 TRCN0000141599 CCTGTGTAACAGGAGAACAAT pLKO.1 1182 3UTR 100% 5.625 3.938 N FAM104A n/a
6 TRCN0000140454 GAAGGAATGGCAACGAAGAAG pLKO.1 318 CDS 100% 4.950 3.465 N FAM104A n/a
7 TRCN0000141905 GAATGGCAACGAAGAAGACAA pLKO.1 322 CDS 100% 4.950 3.465 N FAM104A n/a
8 TRCN0000144914 GCAGTTGTTTACTTGTGGTTT pLKO.1 794 3UTR 100% 4.950 3.465 N FAM104A n/a
9 TRCN0000141446 CAACGAAGAAGACAACCATCT pLKO.1 328 CDS 100% 4.050 2.835 N FAM104A n/a
10 TRCN0000140084 GAGAAGGAATGGCAACGAAGA pLKO.1 316 CDS 100% 4.050 2.835 N FAM104A n/a
11 TRCN0000140455 GCAACGAAGAAGACAACCATC pLKO.1 327 CDS 100% 4.050 2.835 N FAM104A n/a
12 TRCN0000139989 GAAGTAGCAGAAACCCTGTCT pLKO.1 366 CDS 100% 2.640 1.848 N FAM104A n/a
13 TRCN0000139625 CTACTTCCACATCAACCAGAC pLKO.1 574 CDS 100% 2.250 1.350 N FAM104A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_032837.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12882 pDONR223 100% 64.3% 64.5% None 1_198del;375T>C n/a
2 ccsbBroad304_12882 pLX_304 0% 64.3% 64.5% V5 1_198del;375T>C n/a
3 TRCN0000470471 GTCCGCCCCAAAGCGACTCGAATT pLX_317 81% 64.3% 64.5% V5 1_198del;375T>C n/a
Download CSV