Transcript: Human NM_032843.5

Homo sapiens fibrinogen C domain containing 1 (FIBCD1), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-07
Taxon:
Homo sapiens (human)
Gene:
FIBCD1 (84929)
Length:
3650
CDS:
641..2026

Additional Resources:

NCBI RefSeq record:
NM_032843.5
NBCI Gene record:
FIBCD1 (84929)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_032843.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000420989 ATGCGTACCGAGACGGCTTTG pLKO_005 1539 CDS 100% 2.000 2.800 N FIBCD1 n/a
2 TRCN0000428209 GTGAACTCCGTCAGCGACATC pLKO_005 1229 CDS 100% 1.350 1.890 N FIBCD1 n/a
3 TRCN0000421054 ACTGTCTGGACGTCCTCCTAA pLKO_005 1368 CDS 100% 4.950 3.960 N FIBCD1 n/a
4 TRCN0000005542 CTGGCAGTACTCACTCAAGTT pLKO.1 1966 CDS 100% 4.950 3.960 N FIBCD1 n/a
5 TRCN0000005539 CCTCACTCTTTCGTGAATGTT pLKO.1 2083 3UTR 100% 5.625 3.938 N FIBCD1 n/a
6 TRCN0000005541 CAGCGACCATTCAGAGAACAA pLKO.1 1819 CDS 100% 4.950 3.465 N FIBCD1 n/a
7 TRCN0000005540 GATGGCGTCTACTCTGTCTTT pLKO.1 1403 CDS 100% 4.950 3.465 N FIBCD1 n/a
8 TRCN0000427279 GCTCACCGTGGCTGACTATTC pLKO_005 1735 CDS 100% 3.600 2.520 N FIBCD1 n/a
9 TRCN0000412895 CATGAGGTTCACCACCAAGGA pLKO_005 1792 CDS 100% 2.640 1.848 N FIBCD1 n/a
10 TRCN0000427578 GACGGCTCCGTGAACTTCTTC pLKO_005 1508 CDS 100% 1.650 1.155 N FIBCD1 n/a
11 TRCN0000005543 CTCGCACCTCAGCATCCTCAT pLKO.1 901 CDS 100% 1.350 0.945 N FIBCD1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_032843.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09242 pDONR223 100% 99.9% 99.7% None 235C>G n/a
2 ccsbBroad304_09242 pLX_304 0% 99.9% 99.7% V5 235C>G n/a
3 TRCN0000479008 GTTCCGTAGTCGATCCGCCATCGC pLX_317 18.2% 99.9% 99.7% V5 235C>G n/a
Download CSV